Incidental Mutation 'R4874:Dcdc5'
ID 376762
Institutional Source Beutler Lab
Gene Symbol Dcdc5
Ensembl Gene ENSMUSG00000074981
Gene Name doublecortin domain containing 5
Synonyms 4732421G10Rik, EG436559
MMRRC Submission 042484-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.113) question?
Stock # R4874 (G1)
Quality Score 220
Status Validated
Chromosome 2
Chromosomal Location 105833674-106236496 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) T to C at 106198451 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152776
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. Alternatively spliced transcript variants encoding distinct isoforms have been found, but the full-length nature of some variants is not determined. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat G A 8: 60,969,147 (GRCm39) probably null Het
Adamtsl1 A G 4: 86,260,729 (GRCm39) N988S possibly damaging Het
Aph1b A T 9: 66,697,878 (GRCm39) probably null Het
B4galnt3 C A 6: 120,184,167 (GRCm39) R880L probably damaging Het
Bcam T C 7: 19,503,247 (GRCm39) probably benign Het
Cr2 A T 1: 194,858,878 (GRCm39) I14N possibly damaging Het
Dll1 A T 17: 15,590,501 (GRCm39) M405K probably benign Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Ern2 T C 7: 121,775,810 (GRCm39) D428G probably benign Het
Esp36 A T 17: 38,727,987 (GRCm39) M98K unknown Het
Foxd2 G T 4: 114,764,768 (GRCm39) H417Q possibly damaging Het
Glrb T C 3: 80,758,349 (GRCm39) N304D possibly damaging Het
Haus3 A G 5: 34,324,972 (GRCm39) V229A probably benign Het
Hpgd A T 8: 56,770,838 (GRCm39) I159F possibly damaging Het
Ighv1-22 T A 12: 114,710,036 (GRCm39) I70F probably benign Het
Il16 A T 7: 83,310,153 (GRCm39) F584L possibly damaging Het
Lamc2 T C 1: 153,030,141 (GRCm39) D167G probably null Het
Megf10 G A 18: 57,426,930 (GRCm39) V1083I probably benign Het
Mertk T C 2: 128,592,079 (GRCm39) S268P probably damaging Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Mki67 T C 7: 135,310,500 (GRCm39) D132G probably damaging Het
Nbas A G 12: 13,371,756 (GRCm39) N419D probably damaging Het
Negr1 T C 3: 156,565,082 (GRCm39) L56S probably damaging Het
Nup214 A G 2: 31,870,596 (GRCm39) probably null Het
Opn5 C G 17: 42,891,610 (GRCm39) A276P probably damaging Het
Or10j5 A G 1: 172,785,166 (GRCm39) E268G probably benign Het
Or2d3 C T 7: 106,490,642 (GRCm39) V225I probably benign Het
Or5t9 T A 2: 86,659,598 (GRCm39) H167Q probably damaging Het
Papln G T 12: 83,823,917 (GRCm39) V499L probably benign Het
Pgap1 A T 1: 54,569,296 (GRCm39) W357R probably damaging Het
Pibf1 T C 14: 99,377,992 (GRCm39) Y373H probably damaging Het
Pitpnm1 T C 19: 4,162,252 (GRCm39) probably null Het
Prcd T A 11: 116,550,597 (GRCm39) W3R probably null Het
Prkaa1 A G 15: 5,203,838 (GRCm39) N249S probably benign Het
Reg3b T A 6: 78,349,809 (GRCm39) N116K possibly damaging Het
Rpusd2 T C 2: 118,865,360 (GRCm39) L19P probably benign Het
Rufy1 T C 11: 50,297,277 (GRCm39) T392A possibly damaging Het
Sall3 T C 18: 81,017,188 (GRCm39) K247E probably benign Het
Shank1 C T 7: 43,965,497 (GRCm39) T191M unknown Het
Slit1 C T 19: 41,717,493 (GRCm39) probably null Het
Sorl1 A T 9: 41,975,048 (GRCm39) V520E probably damaging Het
Vmn2r115 T A 17: 23,578,825 (GRCm39) F766Y probably damaging Het
Wdr87-ps A G 7: 29,235,608 (GRCm39) noncoding transcript Het
Zfp644 A G 5: 106,783,279 (GRCm39) S1032P probably damaging Het
Other mutations in Dcdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0017:Dcdc5 UTSW 2 106,187,541 (GRCm39) splice site noncoding transcript
R0017:Dcdc5 UTSW 2 106,187,541 (GRCm39) splice site noncoding transcript
R0544:Dcdc5 UTSW 2 106,181,909 (GRCm39) exon noncoding transcript
R0563:Dcdc5 UTSW 2 106,180,035 (GRCm39) exon noncoding transcript
R1456:Dcdc5 UTSW 2 106,181,910 (GRCm39) exon noncoding transcript
R1476:Dcdc5 UTSW 2 106,188,977 (GRCm39) exon noncoding transcript
R1521:Dcdc5 UTSW 2 106,182,014 (GRCm39) critical splice donor site noncoding transcript
R1555:Dcdc5 UTSW 2 106,214,480 (GRCm39) exon noncoding transcript
R2280:Dcdc5 UTSW 2 106,202,867 (GRCm39) critical splice donor site noncoding transcript
R2304:Dcdc5 UTSW 2 106,166,488 (GRCm39) critical splice donor site noncoding transcript
R3775:Dcdc5 UTSW 2 106,202,738 (GRCm39) exon noncoding transcript
R4820:Dcdc5 UTSW 2 106,166,420 (GRCm39) exon noncoding transcript
R4910:Dcdc5 UTSW 2 106,195,895 (GRCm39) exon noncoding transcript
R5285:Dcdc5 UTSW 2 106,198,500 (GRCm39) exon noncoding transcript
R5583:Dcdc5 UTSW 2 106,195,778 (GRCm39) exon noncoding transcript
R5634:Dcdc5 UTSW 2 106,234,325 (GRCm39) exon noncoding transcript
R6313:Dcdc5 UTSW 2 106,198,516 (GRCm39) critical splice donor site noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTGGTGGAGACAAATGCACTTTC -3'
(R):5'- GCTGGAAAGGTGCATCTGAG -3'

Sequencing Primer
(F):5'- GCTATGGAGAGTTCTGTAACAATGC -3'
(R):5'- TGCATCTGAGGGAGGTGAC -3'
Posted On 2016-03-17