Incidental Mutation 'R4874:Dcdc5'
ID376762
Institutional Source Beutler Lab
Gene Symbol Dcdc5
Ensembl Gene ENSMUSG00000074981
Gene Namedoublecortin domain containing 5
SynonymsEG436559, 4732421G10Rik
MMRRC Submission 042484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4874 (G1)
Quality Score220
Status Validated
Chromosome2
Chromosomal Location106003336-106406151 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 106368106 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152776
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. Alternatively spliced transcript variants encoding distinct isoforms have been found, but the full-length nature of some variants is not determined. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,536,183 noncoding transcript Het
Aadat G A 8: 60,516,113 probably null Het
Adamtsl1 A G 4: 86,342,492 N988S possibly damaging Het
Aph1b A T 9: 66,790,596 probably null Het
B4galnt3 C A 6: 120,207,206 R880L probably damaging Het
Bcam T C 7: 19,769,322 probably benign Het
Cr2 A T 1: 195,176,570 I14N possibly damaging Het
Dll1 A T 17: 15,370,239 M405K probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ern2 T C 7: 122,176,587 D428G probably benign Het
Esp36 A T 17: 38,417,096 M98K unknown Het
Foxd2 G T 4: 114,907,571 H417Q possibly damaging Het
Glrb T C 3: 80,851,042 N304D possibly damaging Het
Haus3 A G 5: 34,167,628 V229A probably benign Het
Hpgd A T 8: 56,317,803 I159F possibly damaging Het
Ighv1-22 T A 12: 114,746,416 I70F probably benign Het
Il16 A T 7: 83,660,945 F584L possibly damaging Het
Lamc2 T C 1: 153,154,395 D167G probably null Het
Megf10 G A 18: 57,293,858 V1083I probably benign Het
Mertk T C 2: 128,750,159 S268P probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mki67 T C 7: 135,708,771 D132G probably damaging Het
Nbas A G 12: 13,321,755 N419D probably damaging Het
Negr1 T C 3: 156,859,445 L56S probably damaging Het
Nup214 A G 2: 31,980,584 probably null Het
Olfr1094 T A 2: 86,829,254 H167Q probably damaging Het
Olfr16 A G 1: 172,957,599 E268G probably benign Het
Olfr707 C T 7: 106,891,435 V225I probably benign Het
Opn5 C G 17: 42,580,719 A276P probably damaging Het
Papln G T 12: 83,777,143 V499L probably benign Het
Pgap1 A T 1: 54,530,137 W357R probably damaging Het
Pibf1 T C 14: 99,140,556 Y373H probably damaging Het
Pitpnm1 T C 19: 4,112,252 probably null Het
Prcd T A 11: 116,659,771 W3R probably null Het
Prkaa1 A G 15: 5,174,357 N249S probably benign Het
Reg3b T A 6: 78,372,826 N116K possibly damaging Het
Rpusd2 T C 2: 119,034,879 L19P probably benign Het
Rufy1 T C 11: 50,406,450 T392A possibly damaging Het
Sall3 T C 18: 80,973,973 K247E probably benign Het
Shank1 C T 7: 44,316,073 T191M unknown Het
Slit1 C T 19: 41,729,054 probably null Het
Sorl1 A T 9: 42,063,752 V520E probably damaging Het
Vmn2r115 T A 17: 23,359,851 F766Y probably damaging Het
Zfp644 A G 5: 106,635,413 S1032P probably damaging Het
Other mutations in Dcdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0017:Dcdc5 UTSW 2 106357196 splice site noncoding transcript
R0017:Dcdc5 UTSW 2 106357196 splice site noncoding transcript
R0544:Dcdc5 UTSW 2 106351564 exon noncoding transcript
R0563:Dcdc5 UTSW 2 106349690 exon noncoding transcript
R1456:Dcdc5 UTSW 2 106351565 exon noncoding transcript
R1476:Dcdc5 UTSW 2 106358632 exon noncoding transcript
R1521:Dcdc5 UTSW 2 106351669 critical splice donor site noncoding transcript
R1555:Dcdc5 UTSW 2 106384135 exon noncoding transcript
R2280:Dcdc5 UTSW 2 106372522 critical splice donor site noncoding transcript
R2304:Dcdc5 UTSW 2 106336143 critical splice donor site noncoding transcript
R3775:Dcdc5 UTSW 2 106372393 exon noncoding transcript
R4820:Dcdc5 UTSW 2 106336075 exon noncoding transcript
R4910:Dcdc5 UTSW 2 106365550 exon noncoding transcript
R5285:Dcdc5 UTSW 2 106368155 exon noncoding transcript
R5583:Dcdc5 UTSW 2 106365433 exon noncoding transcript
R5634:Dcdc5 UTSW 2 106403980 exon noncoding transcript
R6313:Dcdc5 UTSW 2 106368171 critical splice donor site noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTGGTGGAGACAAATGCACTTTC -3'
(R):5'- GCTGGAAAGGTGCATCTGAG -3'

Sequencing Primer
(F):5'- GCTATGGAGAGTTCTGTAACAATGC -3'
(R):5'- TGCATCTGAGGGAGGTGAC -3'
Posted On2016-03-17