Incidental Mutation 'R4874:Rpusd2'
ID376763
Institutional Source Beutler Lab
Gene Symbol Rpusd2
Ensembl Gene ENSMUSG00000027324
Gene NameRNA pseudouridylate synthase domain containing 2
SynonymsBB231107, 4921503C21Rik
MMRRC Submission 042484-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4874 (G1)
Quality Score180
Status Validated
Chromosome2
Chromosomal Location119034790-119039769 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119034879 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 19 (L19P)
Ref Sequence ENSEMBL: ENSMUSP00000028796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028796]
Predicted Effect probably benign
Transcript: ENSMUST00000028796
AA Change: L19P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028796
Gene: ENSMUSG00000027324
AA Change: L19P

DomainStartEndE-ValueType
Blast:S4 174 237 4e-28 BLAST
Pfam:PseudoU_synth_2 244 391 4e-34 PFAM
Meta Mutation Damage Score 0.1118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,536,183 noncoding transcript Het
Aadat G A 8: 60,516,113 probably null Het
Adamtsl1 A G 4: 86,342,492 N988S possibly damaging Het
Aph1b A T 9: 66,790,596 probably null Het
B4galnt3 C A 6: 120,207,206 R880L probably damaging Het
Bcam T C 7: 19,769,322 probably benign Het
Cr2 A T 1: 195,176,570 I14N possibly damaging Het
Dcdc5 T C 2: 106,368,106 noncoding transcript Het
Dll1 A T 17: 15,370,239 M405K probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ern2 T C 7: 122,176,587 D428G probably benign Het
Esp36 A T 17: 38,417,096 M98K unknown Het
Foxd2 G T 4: 114,907,571 H417Q possibly damaging Het
Glrb T C 3: 80,851,042 N304D possibly damaging Het
Haus3 A G 5: 34,167,628 V229A probably benign Het
Hpgd A T 8: 56,317,803 I159F possibly damaging Het
Ighv1-22 T A 12: 114,746,416 I70F probably benign Het
Il16 A T 7: 83,660,945 F584L possibly damaging Het
Lamc2 T C 1: 153,154,395 D167G probably null Het
Megf10 G A 18: 57,293,858 V1083I probably benign Het
Mertk T C 2: 128,750,159 S268P probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mki67 T C 7: 135,708,771 D132G probably damaging Het
Nbas A G 12: 13,321,755 N419D probably damaging Het
Negr1 T C 3: 156,859,445 L56S probably damaging Het
Nup214 A G 2: 31,980,584 probably null Het
Olfr1094 T A 2: 86,829,254 H167Q probably damaging Het
Olfr16 A G 1: 172,957,599 E268G probably benign Het
Olfr707 C T 7: 106,891,435 V225I probably benign Het
Opn5 C G 17: 42,580,719 A276P probably damaging Het
Papln G T 12: 83,777,143 V499L probably benign Het
Pgap1 A T 1: 54,530,137 W357R probably damaging Het
Pibf1 T C 14: 99,140,556 Y373H probably damaging Het
Pitpnm1 T C 19: 4,112,252 probably null Het
Prcd T A 11: 116,659,771 W3R probably null Het
Prkaa1 A G 15: 5,174,357 N249S probably benign Het
Reg3b T A 6: 78,372,826 N116K possibly damaging Het
Rufy1 T C 11: 50,406,450 T392A possibly damaging Het
Sall3 T C 18: 80,973,973 K247E probably benign Het
Shank1 C T 7: 44,316,073 T191M unknown Het
Slit1 C T 19: 41,729,054 probably null Het
Sorl1 A T 9: 42,063,752 V520E probably damaging Het
Vmn2r115 T A 17: 23,359,851 F766Y probably damaging Het
Zfp644 A G 5: 106,635,413 S1032P probably damaging Het
Other mutations in Rpusd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Rpusd2 APN 2 119035356 missense probably damaging 1.00
IGL02126:Rpusd2 APN 2 119038638 missense probably damaging 0.98
IGL02136:Rpusd2 APN 2 119038178 missense probably damaging 1.00
PIT4618001:Rpusd2 UTSW 2 119038452 missense possibly damaging 0.93
R0211:Rpusd2 UTSW 2 119038412 missense probably benign
R0211:Rpusd2 UTSW 2 119038412 missense probably benign
R1295:Rpusd2 UTSW 2 119036927 missense probably benign 0.39
R1866:Rpusd2 UTSW 2 119035247 missense probably benign 0.13
R2060:Rpusd2 UTSW 2 119037215 critical splice donor site probably null
R2567:Rpusd2 UTSW 2 119037075 missense probably damaging 1.00
R3963:Rpusd2 UTSW 2 119038604 missense probably benign 0.00
R4133:Rpusd2 UTSW 2 119038715 missense probably damaging 1.00
R4486:Rpusd2 UTSW 2 119035224 missense probably damaging 1.00
R6235:Rpusd2 UTSW 2 119034857 missense probably benign
R6801:Rpusd2 UTSW 2 119035395 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTACTCCAAGCAAGGAC -3'
(R):5'- TCTCTGCGAAGTGCTCATCG -3'

Sequencing Primer
(F):5'- GGACTTCCTCAGACACCTAACTCTG -3'
(R):5'- GAAGTGCTCATCGCTAAAGCTC -3'
Posted On2016-03-17