Mutagenetix > Incidental Mutation

Incidental Mutation 'R4874:Mertk'

376764

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

042484-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R4874 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128750159 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 268 (S268P)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably damaging
Transcript: ENSMUST00000014505
AA Change: S268P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: S268P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145178

Meta Mutation Damage Score

0.3198

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

94% (51/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	A	G	7: 29,536,183		noncoding transcript	Het
Aadat	G	A	8: 60,516,113		probably null	Het
Adamtsl1	A	G	4: 86,342,492	N988S	possibly damaging	Het
Aph1b	A	T	9: 66,790,596		probably null	Het
B4galnt3	C	A	6: 120,207,206	R880L	probably damaging	Het
Bcam	T	C	7: 19,769,322		probably benign	Het
Cr2	A	T	1: 195,176,570	I14N	possibly damaging	Het
Dcdc5	T	C	2: 106,368,106		noncoding transcript	Het
Dll1	A	T	17: 15,370,239	M405K	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ern2	T	C	7: 122,176,587	D428G	probably benign	Het
Esp36	A	T	17: 38,417,096	M98K	unknown	Het
Foxd2	G	T	4: 114,907,571	H417Q	possibly damaging	Het
Glrb	T	C	3: 80,851,042	N304D	possibly damaging	Het
Haus3	A	G	5: 34,167,628	V229A	probably benign	Het
Hpgd	A	T	8: 56,317,803	I159F	possibly damaging	Het
Ighv1-22	T	A	12: 114,746,416	I70F	probably benign	Het
Il16	A	T	7: 83,660,945	F584L	possibly damaging	Het
Lamc2	T	C	1: 153,154,395	D167G	probably null	Het
Megf10	G	A	18: 57,293,858	V1083I	probably benign	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Mki67	T	C	7: 135,708,771	D132G	probably damaging	Het
Nbas	A	G	12: 13,321,755	N419D	probably damaging	Het
Negr1	T	C	3: 156,859,445	L56S	probably damaging	Het
Nup214	A	G	2: 31,980,584		probably null	Het
Olfr1094	T	A	2: 86,829,254	H167Q	probably damaging	Het
Olfr16	A	G	1: 172,957,599	E268G	probably benign	Het
Olfr707	C	T	7: 106,891,435	V225I	probably benign	Het
Opn5	C	G	17: 42,580,719	A276P	probably damaging	Het
Papln	G	T	12: 83,777,143	V499L	probably benign	Het
Pgap1	A	T	1: 54,530,137	W357R	probably damaging	Het
Pibf1	T	C	14: 99,140,556	Y373H	probably damaging	Het
Pitpnm1	T	C	19: 4,112,252		probably null	Het
Prcd	T	A	11: 116,659,771	W3R	probably null	Het
Prkaa1	A	G	15: 5,174,357	N249S	probably benign	Het
Reg3b	T	A	6: 78,372,826	N116K	possibly damaging	Het
Rpusd2	T	C	2: 119,034,879	L19P	probably benign	Het
Rufy1	T	C	11: 50,406,450	T392A	possibly damaging	Het
Sall3	T	C	18: 80,973,973	K247E	probably benign	Het
Shank1	C	T	7: 44,316,073	T191M	unknown	Het
Slit1	C	T	19: 41,729,054		probably null	Het
Sorl1	A	T	9: 42,063,752	V520E	probably damaging	Het
Vmn2r115	T	A	17: 23,359,851	F766Y	probably damaging	Het
Zfp644	A	G	5: 106,635,413	S1032P	probably damaging	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
R8953:Mertk	UTSW	2	128778796	intron	probably benign
R9135:Mertk	UTSW	2	128762115	missense	probably benign	0.23
R9153:Mertk	UTSW	2	128782567	missense	probably damaging	1.00
R9176:Mertk	UTSW	2	128778972	missense	possibly damaging	0.62
R9443:Mertk	UTSW	2	128762109	missense	probably benign	0.00
R9574:Mertk	UTSW	2	128751960	missense	probably benign	0.03
R9582:Mertk	UTSW	2	128782607	missense	possibly damaging	0.55
R9616:Mertk	UTSW	2	128801335	missense	probably benign	0.01
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTTTAGGCTAGACGCTATGAACC -3'
(R):5'- ATGTGCCAAGAACTGCTATGAC -3'

Sequencing Primer
(F):5'- GCTATGAACCAAGAAATAAAAGCTGC -3'
(R):5'- GCCAAGAACTGCTATGACTATATTAC -3'

Posted On

2016-03-17