Mutagenetix > Incidental Mutations

Incidental Mutation 'R4874:Adamtsl1'

376767

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl1

Ensembl Gene

ENSMUSG00000066113

Gene Name

ADAMTS-like 1

Synonyms

5930437A14Rik, 6720426B09Rik, punctin-1

MMRRC Submission

042484-MU

Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R4874 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85514172-86428385 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86342492 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 988 (N988S)

Ref Sequence

ENSEMBL: ENSMUSP00000102796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000141889]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107177

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107178
AA Change: N988S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: N988S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	362	421	2.05e-2	SMART
TSP1	422	476	3.99e-4	SMART
TSP1	508	567	6.39e-3	SMART
TSP1	593	650	7.86e-3	SMART
TSP1	652	712	3.78e-5	SMART
TSP1	715	772	2.66e-2	SMART
TSP1	774	833	1.62e-4	SMART
IGc2	873	937	4.19e-6	SMART
low complexity region	1123	1142	N/A	INTRINSIC
IGc2	1175	1240	1.31e-7	SMART
IGc2	1282	1351	7.81e-15	SMART
IGc2	1400	1467	2.39e-10	SMART
TSP1	1481	1537	2.12e-1	SMART
TSP1	1540	1599	1.74e-4	SMART
TSP1	1600	1658	8.2e0	SMART
TSP1	1660	1717	1.96e-1	SMART
Pfam:PLAC	1721	1751	1.4e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141889
AA Change: N980S

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: N980S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	379	438	2.05e-2	SMART
TSP1	439	493	3.99e-4	SMART
TSP1	525	584	6.39e-3	SMART
TSP1	610	667	7.86e-3	SMART
TSP1	707	764	2.66e-2	SMART
TSP1	766	825	1.62e-4	SMART
IGc2	865	929	4.19e-6	SMART
low complexity region	1115	1134	N/A	INTRINSIC
IGc2	1167	1232	1.31e-7	SMART
IGc2	1274	1343	7.81e-15	SMART
IGc2	1392	1459	2.39e-10	SMART
TSP1	1473	1529	2.12e-1	SMART
TSP1	1532	1591	1.74e-4	SMART
TSP1	1592	1650	8.2e0	SMART
TSP1	1652	1709	1.96e-1	SMART
Pfam:PLAC	1712	1744	5.6e-12	PFAM

Meta Mutation Damage Score

0.0769

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

94% (51/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	A	G	7: 29,536,183		noncoding transcript	Het
Aadat	G	A	8: 60,516,113		probably null	Het
Aph1b	A	T	9: 66,790,596		probably null	Het
B4galnt3	C	A	6: 120,207,206	R880L	probably damaging	Het
Bcam	T	C	7: 19,769,322		probably benign	Het
Cr2	A	T	1: 195,176,570	I14N	possibly damaging	Het
Dcdc5	T	C	2: 106,368,106		noncoding transcript	Het
Dll1	A	T	17: 15,370,239	M405K	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ern2	T	C	7: 122,176,587	D428G	probably benign	Het
Esp36	A	T	17: 38,417,096	M98K	unknown	Het
Foxd2	G	T	4: 114,907,571	H417Q	possibly damaging	Het
Glrb	T	C	3: 80,851,042	N304D	possibly damaging	Het
Haus3	A	G	5: 34,167,628	V229A	probably benign	Het
Hpgd	A	T	8: 56,317,803	I159F	possibly damaging	Het
Ighv1-22	T	A	12: 114,746,416	I70F	probably benign	Het
Il16	A	T	7: 83,660,945	F584L	possibly damaging	Het
Lamc2	T	C	1: 153,154,395	D167G	probably null	Het
Megf10	G	A	18: 57,293,858	V1083I	probably benign	Het
Mertk	T	C	2: 128,750,159	S268P	probably damaging	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Mki67	T	C	7: 135,708,771	D132G	probably damaging	Het
Nbas	A	G	12: 13,321,755	N419D	probably damaging	Het
Negr1	T	C	3: 156,859,445	L56S	probably damaging	Het
Nup214	A	G	2: 31,980,584		probably null	Het
Olfr1094	T	A	2: 86,829,254	H167Q	probably damaging	Het
Olfr16	A	G	1: 172,957,599	E268G	probably benign	Het
Olfr707	C	T	7: 106,891,435	V225I	probably benign	Het
Opn5	C	G	17: 42,580,719	A276P	probably damaging	Het
Papln	G	T	12: 83,777,143	V499L	probably benign	Het
Pgap1	A	T	1: 54,530,137	W357R	probably damaging	Het
Pibf1	T	C	14: 99,140,556	Y373H	probably damaging	Het
Pitpnm1	T	C	19: 4,112,252		probably null	Het
Prcd	T	A	11: 116,659,771	W3R	probably null	Het
Prkaa1	A	G	15: 5,174,357	N249S	probably benign	Het
Reg3b	T	A	6: 78,372,826	N116K	possibly damaging	Het
Rpusd2	T	C	2: 119,034,879	L19P	probably benign	Het
Rufy1	T	C	11: 50,406,450	T392A	possibly damaging	Het
Sall3	T	C	18: 80,973,973	K247E	probably benign	Het
Shank1	C	T	7: 44,316,073	T191M	unknown	Het
Slit1	C	T	19: 41,729,054		probably null	Het
Sorl1	A	T	9: 42,063,752	V520E	probably damaging	Het
Vmn2r115	T	A	17: 23,359,851	F766Y	probably damaging	Het
Zfp644	A	G	5: 106,635,413	S1032P	probably damaging	Het

Other mutations in Adamtsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Adamtsl1	APN	4	86385640	missense	probably benign	0.01
IGL00741:Adamtsl1	APN	4	86276948	missense	probably damaging	1.00
IGL00770:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00774:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00826:Adamtsl1	APN	4	86156804	missense	probably damaging	1.00
IGL00938:Adamtsl1	APN	4	86342278	missense	possibly damaging	0.93
IGL01012:Adamtsl1	APN	4	86342189	missense	possibly damaging	0.93
IGL01728:Adamtsl1	APN	4	86110837	missense	probably damaging	1.00
IGL01801:Adamtsl1	APN	4	86199322	missense	probably benign	0.23
IGL01922:Adamtsl1	APN	4	86249902	missense	probably damaging	1.00
IGL02006:Adamtsl1	APN	4	86199345	missense	probably damaging	1.00
IGL02192:Adamtsl1	APN	4	86228016	missense	probably damaging	1.00
IGL02351:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02358:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02373:Adamtsl1	APN	4	86249805	missense	probably damaging	1.00
IGL02660:Adamtsl1	APN	4	86232610	missense	probably damaging	1.00
IGL02964:Adamtsl1	APN	4	86424357	missense	probably damaging	1.00
IGL03233:Adamtsl1	APN	4	86342120	missense	probably damaging	1.00
IGL03297:Adamtsl1	APN	4	86423426	missense	probably damaging	0.98
IGL03326:Adamtsl1	APN	4	86252748	splice site	probably benign
PIT4378001:Adamtsl1	UTSW	4	86199364	missense	possibly damaging	0.93
PIT4418001:Adamtsl1	UTSW	4	86243724	missense	probably damaging	1.00
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0132:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0453:Adamtsl1	UTSW	4	86232615	missense	probably damaging	1.00
R0480:Adamtsl1	UTSW	4	86252818	missense	probably benign	0.08
R0496:Adamtsl1	UTSW	4	86341198	missense	probably damaging	1.00
R0538:Adamtsl1	UTSW	4	86343121	missense	probably benign	0.27
R0547:Adamtsl1	UTSW	4	86356355	missense	probably benign	0.37
R0567:Adamtsl1	UTSW	4	86228016	missense	probably damaging	1.00
R0568:Adamtsl1	UTSW	4	86418552	missense	probably damaging	1.00
R0639:Adamtsl1	UTSW	4	86277143	missense	probably damaging	1.00
R0931:Adamtsl1	UTSW	4	86249847	missense	probably benign	0.05
R1186:Adamtsl1	UTSW	4	86388509	missense	probably benign	0.00
R1387:Adamtsl1	UTSW	4	86374993	splice site	probably benign
R1459:Adamtsl1	UTSW	4	86425865	missense	probably damaging	1.00
R1518:Adamtsl1	UTSW	4	86342603	missense	probably damaging	0.99
R1532:Adamtsl1	UTSW	4	86248065	missense	probably benign	0.02
R1603:Adamtsl1	UTSW	4	86415530	missense	probably benign
R1931:Adamtsl1	UTSW	4	86342411	missense	possibly damaging	0.62
R2086:Adamtsl1	UTSW	4	86228012	missense	probably damaging	1.00
R2221:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2223:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2396:Adamtsl1	UTSW	4	86343119	nonsense	probably null
R2397:Adamtsl1	UTSW	4	86199357	missense	probably damaging	1.00
R2426:Adamtsl1	UTSW	4	86156788	missense	probably benign	0.01
R3121:Adamtsl1	UTSW	4	86337009	missense	probably damaging	1.00
R3715:Adamtsl1	UTSW	4	86216976	missense	probably benign	0.01
R3848:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3849:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3850:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R4194:Adamtsl1	UTSW	4	86054008	intron	probably benign
R4354:Adamtsl1	UTSW	4	86156684	missense	probably damaging	1.00
R4795:Adamtsl1	UTSW	4	86243769	critical splice donor site	probably null
R4830:Adamtsl1	UTSW	4	86356382	missense	probably damaging	0.97
R4939:Adamtsl1	UTSW	4	86243725	missense	possibly damaging	0.95
R4942:Adamtsl1	UTSW	4	86341214	nonsense	probably null
R4947:Adamtsl1	UTSW	4	85764800	missense	possibly damaging	0.93
R4960:Adamtsl1	UTSW	4	86424173	nonsense	probably null
R4971:Adamtsl1	UTSW	4	86336931	missense	probably damaging	1.00
R5141:Adamtsl1	UTSW	4	86156850	missense	possibly damaging	0.77
R5213:Adamtsl1	UTSW	4	86385628	missense	possibly damaging	0.89
R5237:Adamtsl1	UTSW	4	86385669	critical splice donor site	probably null
R5250:Adamtsl1	UTSW	4	86216945	nonsense	probably null
R5411:Adamtsl1	UTSW	4	86388413	critical splice acceptor site	probably null
R5554:Adamtsl1	UTSW	4	86276945	missense	possibly damaging	0.69
R5631:Adamtsl1	UTSW	4	86276923	nonsense	probably null
R5739:Adamtsl1	UTSW	4	86232664	missense	probably damaging	1.00
R5905:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6028:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6044:Adamtsl1	UTSW	4	86212691	missense	probably damaging	1.00
R6261:Adamtsl1	UTSW	4	86336878	missense	probably benign	0.09
R6300:Adamtsl1	UTSW	4	86248017	missense	probably damaging	1.00
R6332:Adamtsl1	UTSW	4	86217011	missense	probably damaging	0.96
R6560:Adamtsl1	UTSW	4	86336893	missense	probably damaging	1.00
R6693:Adamtsl1	UTSW	4	86342886	missense	probably benign	0.27
R6736:Adamtsl1	UTSW	4	86342247	missense	probably damaging	1.00
R6964:Adamtsl1	UTSW	4	86156854	missense	probably damaging	1.00
R7064:Adamtsl1	UTSW	4	86342041	missense	possibly damaging	0.80
R7434:Adamtsl1	UTSW	4	86425878	missense	probably damaging	0.99
R7477:Adamtsl1	UTSW	4	86415651	missense	probably damaging	1.00
R7545:Adamtsl1	UTSW	4	85764855	missense	probably damaging	1.00
R7556:Adamtsl1	UTSW	4	86277121	missense	probably benign	0.19
R7580:Adamtsl1	UTSW	4	86054064	missense	possibly damaging	0.53
R7593:Adamtsl1	UTSW	4	86341213	missense	probably damaging	1.00
R7710:Adamtsl1	UTSW	4	86232573	missense
R7908:Adamtsl1	UTSW	4	86356439	missense	probably benign	0.02
R7989:Adamtsl1	UTSW	4	86356439	missense	probably benign	0.02
R8056:Adamtsl1	UTSW	4	86342032	missense	not run
Z1176:Adamtsl1	UTSW	4	86342177	missense	not run
Z1176:Adamtsl1	UTSW	4	86342693	missense	not run

Predicted Primers

PCR Primer
(F):5'- TACCTGAAGATCCATCGCCTC -3'
(R):5'- CCTGTTCAGCATTGGGATCCTC -3'

Sequencing Primer
(F):5'- ATGCGGGCATCTACACCTG -3'
(R):5'- CAGCATTGGGATCCTCTTCTGAG -3'

Posted On

2016-03-17