Incidental Mutation 'R4874:B4galnt3'
ID376773
Institutional Source Beutler Lab
Gene Symbol B4galnt3
Ensembl Gene ENSMUSG00000041372
Gene Namebeta-1,4-N-acetyl-galactosaminyl transferase 3
Synonyms
MMRRC Submission 042484-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4874 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location120203073-120294559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120207206 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 880 (R880L)
Ref Sequence ENSEMBL: ENSMUSP00000148759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057283] [ENSMUST00000212457]
Predicted Effect probably damaging
Transcript: ENSMUST00000057283
AA Change: R881L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058253
Gene: ENSMUSG00000041372
AA Change: R881L

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
PA14 129 276 1.16e-21 SMART
low complexity region 591 612 N/A INTRINSIC
Pfam:CHGN 650 985 3.9e-29 PFAM
Pfam:Glyco_transf_7C 896 974 3.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125341
Predicted Effect probably damaging
Transcript: ENSMUST00000212457
AA Change: R880L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] B4GALNT3 transfers N-acetylgalactosamine (GalNAc) onto glucosyl residues to form N,N-prime-diacetyllactosediamine (LacdiNAc, or LDN), a unique terminal structure of cell surface N-glycans (Ikehara et al., 2006 [PubMed 16728562]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,536,183 noncoding transcript Het
Aadat G A 8: 60,516,113 probably null Het
Adamtsl1 A G 4: 86,342,492 N988S possibly damaging Het
Aph1b A T 9: 66,790,596 probably null Het
Bcam T C 7: 19,769,322 probably benign Het
Cr2 A T 1: 195,176,570 I14N possibly damaging Het
Dcdc5 T C 2: 106,368,106 noncoding transcript Het
Dll1 A T 17: 15,370,239 M405K probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ern2 T C 7: 122,176,587 D428G probably benign Het
Esp36 A T 17: 38,417,096 M98K unknown Het
Foxd2 G T 4: 114,907,571 H417Q possibly damaging Het
Glrb T C 3: 80,851,042 N304D possibly damaging Het
Haus3 A G 5: 34,167,628 V229A probably benign Het
Hpgd A T 8: 56,317,803 I159F possibly damaging Het
Ighv1-22 T A 12: 114,746,416 I70F probably benign Het
Il16 A T 7: 83,660,945 F584L possibly damaging Het
Lamc2 T C 1: 153,154,395 D167G probably null Het
Megf10 G A 18: 57,293,858 V1083I probably benign Het
Mertk T C 2: 128,750,159 S268P probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mki67 T C 7: 135,708,771 D132G probably damaging Het
Nbas A G 12: 13,321,755 N419D probably damaging Het
Negr1 T C 3: 156,859,445 L56S probably damaging Het
Nup214 A G 2: 31,980,584 probably null Het
Olfr1094 T A 2: 86,829,254 H167Q probably damaging Het
Olfr16 A G 1: 172,957,599 E268G probably benign Het
Olfr707 C T 7: 106,891,435 V225I probably benign Het
Opn5 C G 17: 42,580,719 A276P probably damaging Het
Papln G T 12: 83,777,143 V499L probably benign Het
Pgap1 A T 1: 54,530,137 W357R probably damaging Het
Pibf1 T C 14: 99,140,556 Y373H probably damaging Het
Pitpnm1 T C 19: 4,112,252 probably null Het
Prcd T A 11: 116,659,771 W3R probably null Het
Prkaa1 A G 15: 5,174,357 N249S probably benign Het
Reg3b T A 6: 78,372,826 N116K possibly damaging Het
Rpusd2 T C 2: 119,034,879 L19P probably benign Het
Rufy1 T C 11: 50,406,450 T392A possibly damaging Het
Sall3 T C 18: 80,973,973 K247E probably benign Het
Shank1 C T 7: 44,316,073 T191M unknown Het
Slit1 C T 19: 41,729,054 probably null Het
Sorl1 A T 9: 42,063,752 V520E probably damaging Het
Vmn2r115 T A 17: 23,359,851 F766Y probably damaging Het
Zfp644 A G 5: 106,635,413 S1032P probably damaging Het
Other mutations in B4galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:B4galnt3 APN 6 120215390 missense possibly damaging 0.87
IGL01543:B4galnt3 APN 6 120209312 missense probably benign 0.00
IGL02692:B4galnt3 APN 6 120210311 missense probably damaging 1.00
IGL03149:B4galnt3 APN 6 120231594 splice site probably benign
IGL03272:B4galnt3 APN 6 120216306 missense probably damaging 1.00
Minimus UTSW 6 120215057 missense probably benign
R0121:B4galnt3 UTSW 6 120215038 missense probably benign
R0414:B4galnt3 UTSW 6 120216565 missense probably benign 0.05
R1885:B4galnt3 UTSW 6 120223640 missense probably damaging 0.99
R1908:B4galnt3 UTSW 6 120210090 critical splice donor site probably null
R2264:B4galnt3 UTSW 6 120203810 makesense probably null
R4208:B4galnt3 UTSW 6 120215102 missense probably damaging 0.99
R4353:B4galnt3 UTSW 6 120215476 missense possibly damaging 0.89
R4649:B4galnt3 UTSW 6 120224620 missense probably damaging 1.00
R5046:B4galnt3 UTSW 6 120214798 missense probably damaging 1.00
R5232:B4galnt3 UTSW 6 120232988 missense probably damaging 1.00
R5431:B4galnt3 UTSW 6 120218967 missense probably damaging 1.00
R5447:B4galnt3 UTSW 6 120215057 missense probably benign
R5458:B4galnt3 UTSW 6 120210385 missense probably damaging 0.98
R5793:B4galnt3 UTSW 6 120208904 critical splice donor site probably null
R5954:B4galnt3 UTSW 6 120225188 missense possibly damaging 0.88
R5985:B4galnt3 UTSW 6 120210158 missense probably damaging 1.00
R6156:B4galnt3 UTSW 6 120214840 missense probably benign 0.02
R6176:B4galnt3 UTSW 6 120224164 missense probably damaging 1.00
R6207:B4galnt3 UTSW 6 120206614 splice site probably null
R6565:B4galnt3 UTSW 6 120217479 nonsense probably null
R7153:B4galnt3 UTSW 6 120214968 missense probably benign 0.00
R7268:B4galnt3 UTSW 6 120215042 missense possibly damaging 0.92
R7307:B4galnt3 UTSW 6 120215431 missense probably benign 0.00
R7311:B4galnt3 UTSW 6 120215435 nonsense probably null
R7360:B4galnt3 UTSW 6 120232979 nonsense probably null
R7538:B4galnt3 UTSW 6 120294423 nonsense probably null
R7674:B4galnt3 UTSW 6 120215205 missense probably benign 0.01
R7706:B4galnt3 UTSW 6 120218952 missense probably benign 0.16
R7727:B4galnt3 UTSW 6 120225187 missense probably benign 0.03
X0028:B4galnt3 UTSW 6 120231552 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCCTGAGGTCTGTCCAAAG -3'
(R):5'- GAGATTGTAGAAATTTGCCCTGTG -3'

Sequencing Primer
(F):5'- TGAGGTCTGTCCAAAGCTCAGAC -3'
(R):5'- AGAAATTTGCCCTGTGTTTGG -3'
Posted On2016-03-17