Incidental Mutation 'R4874:Papln'
ID376789
Institutional Source Beutler Lab
Gene Symbol Papln
Ensembl Gene ENSMUSG00000021223
Gene Namepapilin, proteoglycan-like sulfated glycoprotein
SynonymsE030033C16Rik
MMRRC Submission 042484-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4874 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location83763634-83792382 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 83777143 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 499 (V499L)
Ref Sequence ENSEMBL: ENSMUSP00000113806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000121733]
Predicted Effect probably benign
Transcript: ENSMUST00000021646
AA Change: V477L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223
AA Change: V477L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 3.3e-39 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 366 426 2.76e-7 SMART
TSP1 427 482 1.42e-9 SMART
TSP1 488 540 2.47e-9 SMART
low complexity region 604 621 N/A INTRINSIC
KU 748 801 1.83e-22 SMART
low complexity region 822 831 N/A INTRINSIC
IGc2 917 980 2.88e-4 SMART
IGc2 1056 1119 2.66e-17 SMART
IGc2 1145 1209 2.13e-7 SMART
Pfam:PLAC 1234 1268 2.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121733
AA Change: V499L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223
AA Change: V499L

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 2.8e-38 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 388 448 1.82e-7 SMART
TSP1 449 504 1.42e-9 SMART
TSP1 510 562 2.47e-9 SMART
low complexity region 626 643 N/A INTRINSIC
KU 770 823 1.83e-22 SMART
Pfam:Papilin_u7 831 922 1.9e-40 PFAM
IGc2 939 1002 2.88e-4 SMART
IGc2 1078 1141 2.66e-17 SMART
IGc2 1167 1231 2.13e-7 SMART
Pfam:PLAC 1257 1289 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152904
Meta Mutation Damage Score 0.0663 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,536,183 noncoding transcript Het
Aadat G A 8: 60,516,113 probably null Het
Adamtsl1 A G 4: 86,342,492 N988S possibly damaging Het
Aph1b A T 9: 66,790,596 probably null Het
B4galnt3 C A 6: 120,207,206 R880L probably damaging Het
Bcam T C 7: 19,769,322 probably benign Het
Cr2 A T 1: 195,176,570 I14N possibly damaging Het
Dcdc5 T C 2: 106,368,106 noncoding transcript Het
Dll1 A T 17: 15,370,239 M405K probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ern2 T C 7: 122,176,587 D428G probably benign Het
Esp36 A T 17: 38,417,096 M98K unknown Het
Foxd2 G T 4: 114,907,571 H417Q possibly damaging Het
Glrb T C 3: 80,851,042 N304D possibly damaging Het
Haus3 A G 5: 34,167,628 V229A probably benign Het
Hpgd A T 8: 56,317,803 I159F possibly damaging Het
Ighv1-22 T A 12: 114,746,416 I70F probably benign Het
Il16 A T 7: 83,660,945 F584L possibly damaging Het
Lamc2 T C 1: 153,154,395 D167G probably null Het
Megf10 G A 18: 57,293,858 V1083I probably benign Het
Mertk T C 2: 128,750,159 S268P probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mki67 T C 7: 135,708,771 D132G probably damaging Het
Nbas A G 12: 13,321,755 N419D probably damaging Het
Negr1 T C 3: 156,859,445 L56S probably damaging Het
Nup214 A G 2: 31,980,584 probably null Het
Olfr1094 T A 2: 86,829,254 H167Q probably damaging Het
Olfr16 A G 1: 172,957,599 E268G probably benign Het
Olfr707 C T 7: 106,891,435 V225I probably benign Het
Opn5 C G 17: 42,580,719 A276P probably damaging Het
Pgap1 A T 1: 54,530,137 W357R probably damaging Het
Pibf1 T C 14: 99,140,556 Y373H probably damaging Het
Pitpnm1 T C 19: 4,112,252 probably null Het
Prcd T A 11: 116,659,771 W3R probably null Het
Prkaa1 A G 15: 5,174,357 N249S probably benign Het
Reg3b T A 6: 78,372,826 N116K possibly damaging Het
Rpusd2 T C 2: 119,034,879 L19P probably benign Het
Rufy1 T C 11: 50,406,450 T392A possibly damaging Het
Sall3 T C 18: 80,973,973 K247E probably benign Het
Shank1 C T 7: 44,316,073 T191M unknown Het
Slit1 C T 19: 41,729,054 probably null Het
Sorl1 A T 9: 42,063,752 V520E probably damaging Het
Vmn2r115 T A 17: 23,359,851 F766Y probably damaging Het
Zfp644 A G 5: 106,635,413 S1032P probably damaging Het
Other mutations in Papln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Papln APN 12 83770436 missense possibly damaging 0.81
IGL01788:Papln APN 12 83775462 missense probably benign 0.32
IGL01889:Papln APN 12 83786835 missense probably benign 0.25
IGL02499:Papln APN 12 83780671 missense probably benign 0.00
IGL02567:Papln APN 12 83778837 missense probably benign 0.00
IGL03150:Papln APN 12 83782984 missense probably damaging 1.00
IGL03331:Papln APN 12 83783661 missense probably benign
F5770:Papln UTSW 12 83778834 missense possibly damaging 0.72
R0201:Papln UTSW 12 83783027 splice site probably benign
R0389:Papln UTSW 12 83783379 nonsense probably null
R0763:Papln UTSW 12 83791865 missense possibly damaging 0.54
R1508:Papln UTSW 12 83782916 missense probably damaging 0.99
R1628:Papln UTSW 12 83784406 splice site probably benign
R1920:Papln UTSW 12 83789254 nonsense probably null
R1974:Papln UTSW 12 83782037 missense probably damaging 0.98
R2004:Papln UTSW 12 83773218 missense probably damaging 1.00
R2105:Papln UTSW 12 83780236 missense probably benign 0.04
R2876:Papln UTSW 12 83778927 missense probably damaging 0.96
R4199:Papln UTSW 12 83783392 missense probably null 0.01
R4702:Papln UTSW 12 83781983 missense probably benign 0.01
R4705:Papln UTSW 12 83777208 splice site probably null
R4835:Papln UTSW 12 83774420 missense probably damaging 0.99
R4938:Papln UTSW 12 83782903 missense probably benign 0.35
R5000:Papln UTSW 12 83774889 missense probably damaging 1.00
R5149:Papln UTSW 12 83771882 splice site probably null
R5324:Papln UTSW 12 83774571 missense probably damaging 1.00
R5784:Papln UTSW 12 83781980 missense probably benign
R5881:Papln UTSW 12 83771878 missense probably null 0.91
R5977:Papln UTSW 12 83784369 nonsense probably null
R6035:Papln UTSW 12 83774680 missense probably damaging 1.00
R6035:Papln UTSW 12 83774680 missense probably damaging 1.00
R6291:Papln UTSW 12 83783015 missense probably benign 0.01
R6461:Papln UTSW 12 83781813 splice site probably null
R6536:Papln UTSW 12 83781887 missense probably damaging 1.00
R6861:Papln UTSW 12 83774949 missense probably damaging 1.00
R6898:Papln UTSW 12 83777460 missense probably benign 0.03
R6953:Papln UTSW 12 83781885 nonsense probably null
R7155:Papln UTSW 12 83776521 missense probably damaging 1.00
R7450:Papln UTSW 12 83780171 missense probably benign 0.13
R7510:Papln UTSW 12 83772173 missense probably damaging 0.99
V7580:Papln UTSW 12 83778834 missense possibly damaging 0.72
V7581:Papln UTSW 12 83778834 missense possibly damaging 0.72
V7582:Papln UTSW 12 83778834 missense possibly damaging 0.72
Z1088:Papln UTSW 12 83776376 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATGCCACCTGTTCTCTGAGC -3'
(R):5'- CTTTTAGAGCACTGAAGGCCC -3'

Sequencing Primer
(F):5'- ACCTGTTCTCTGAGCCACAG -3'
(R):5'- ACTGAAGGCCCAGGGTG -3'
Posted On2016-03-17