Incidental Mutation 'R4874:Pibf1'
ID376792
Institutional Source Beutler Lab
Gene Symbol Pibf1
Ensembl Gene ENSMUSG00000022064
Gene Nameprogesterone immunomodulatory binding factor 1
Synonyms1700017E21Rik, 4933438D16Rik, 4933439E17Rik, D14Ertd581e, 4930513H15Rik
MMRRC Submission 042484-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4874 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location99099424-99254493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99140556 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 373 (Y373H)
Ref Sequence ENSEMBL: ENSMUSP00000022650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022650]
Predicted Effect probably damaging
Transcript: ENSMUST00000022650
AA Change: Y373H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022650
Gene: ENSMUSG00000022064
AA Change: Y373H

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
coiled coil region 58 165 N/A INTRINSIC
coiled coil region 200 364 N/A INTRINSIC
coiled coil region 396 444 N/A INTRINSIC
coiled coil region 474 553 N/A INTRINSIC
coiled coil region 586 679 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228598
Meta Mutation Damage Score 0.1366 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,536,183 noncoding transcript Het
Aadat G A 8: 60,516,113 probably null Het
Adamtsl1 A G 4: 86,342,492 N988S possibly damaging Het
Aph1b A T 9: 66,790,596 probably null Het
B4galnt3 C A 6: 120,207,206 R880L probably damaging Het
Bcam T C 7: 19,769,322 probably benign Het
Cr2 A T 1: 195,176,570 I14N possibly damaging Het
Dcdc5 T C 2: 106,368,106 noncoding transcript Het
Dll1 A T 17: 15,370,239 M405K probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ern2 T C 7: 122,176,587 D428G probably benign Het
Esp36 A T 17: 38,417,096 M98K unknown Het
Foxd2 G T 4: 114,907,571 H417Q possibly damaging Het
Glrb T C 3: 80,851,042 N304D possibly damaging Het
Haus3 A G 5: 34,167,628 V229A probably benign Het
Hpgd A T 8: 56,317,803 I159F possibly damaging Het
Ighv1-22 T A 12: 114,746,416 I70F probably benign Het
Il16 A T 7: 83,660,945 F584L possibly damaging Het
Lamc2 T C 1: 153,154,395 D167G probably null Het
Megf10 G A 18: 57,293,858 V1083I probably benign Het
Mertk T C 2: 128,750,159 S268P probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mki67 T C 7: 135,708,771 D132G probably damaging Het
Nbas A G 12: 13,321,755 N419D probably damaging Het
Negr1 T C 3: 156,859,445 L56S probably damaging Het
Nup214 A G 2: 31,980,584 probably null Het
Olfr1094 T A 2: 86,829,254 H167Q probably damaging Het
Olfr16 A G 1: 172,957,599 E268G probably benign Het
Olfr707 C T 7: 106,891,435 V225I probably benign Het
Opn5 C G 17: 42,580,719 A276P probably damaging Het
Papln G T 12: 83,777,143 V499L probably benign Het
Pgap1 A T 1: 54,530,137 W357R probably damaging Het
Pitpnm1 T C 19: 4,112,252 probably null Het
Prcd T A 11: 116,659,771 W3R probably null Het
Prkaa1 A G 15: 5,174,357 N249S probably benign Het
Reg3b T A 6: 78,372,826 N116K possibly damaging Het
Rpusd2 T C 2: 119,034,879 L19P probably benign Het
Rufy1 T C 11: 50,406,450 T392A possibly damaging Het
Sall3 T C 18: 80,973,973 K247E probably benign Het
Shank1 C T 7: 44,316,073 T191M unknown Het
Slit1 C T 19: 41,729,054 probably null Het
Sorl1 A T 9: 42,063,752 V520E probably damaging Het
Vmn2r115 T A 17: 23,359,851 F766Y probably damaging Het
Zfp644 A G 5: 106,635,413 S1032P probably damaging Het
Other mutations in Pibf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Pibf1 APN 14 99179449 nonsense probably null
IGL01649:Pibf1 APN 14 99187763 missense possibly damaging 0.88
IGL01817:Pibf1 APN 14 99186472 splice site probably benign
IGL02322:Pibf1 APN 14 99210983 missense probably damaging 1.00
IGL03180:Pibf1 APN 14 99133344 missense probably benign 0.14
IGL03269:Pibf1 APN 14 99187735 missense probably damaging 0.98
IGL03354:Pibf1 APN 14 99150738 missense probably benign 0.13
R0053:Pibf1 UTSW 14 99140557 missense probably damaging 1.00
R0969:Pibf1 UTSW 14 99196386 missense probably benign 0.02
R0981:Pibf1 UTSW 14 99150743 critical splice donor site probably null
R1110:Pibf1 UTSW 14 99112973 missense probably damaging 0.99
R1205:Pibf1 UTSW 14 99101203 missense probably damaging 1.00
R1356:Pibf1 UTSW 14 99137196 missense possibly damaging 0.91
R1432:Pibf1 UTSW 14 99112989 missense probably benign 0.14
R1622:Pibf1 UTSW 14 99186481 missense probably benign 0.34
R1912:Pibf1 UTSW 14 99187809 critical splice donor site probably null
R2393:Pibf1 UTSW 14 99242932 missense probably benign 0.07
R3847:Pibf1 UTSW 14 99137121 missense possibly damaging 0.57
R4028:Pibf1 UTSW 14 99179341 missense probably damaging 0.99
R4673:Pibf1 UTSW 14 99133351 missense possibly damaging 0.93
R4857:Pibf1 UTSW 14 99186501 nonsense probably null
R4992:Pibf1 UTSW 14 99150667 missense probably damaging 0.98
R5330:Pibf1 UTSW 14 99140646 missense probably damaging 1.00
R5543:Pibf1 UTSW 14 99112992 missense probably benign 0.38
R5582:Pibf1 UTSW 14 99137130 missense possibly damaging 0.64
R5922:Pibf1 UTSW 14 99137088 missense probably benign
R6088:Pibf1 UTSW 14 99179358 missense probably benign 0.01
R6169:Pibf1 UTSW 14 99113007 missense probably null 0.96
R6226:Pibf1 UTSW 14 99101119 missense probably damaging 1.00
R6232:Pibf1 UTSW 14 99186578 missense probably benign 0.16
R6339:Pibf1 UTSW 14 99107398 missense probably damaging 0.97
R6450:Pibf1 UTSW 14 99137210 missense probably damaging 1.00
R6828:Pibf1 UTSW 14 99186551 missense probably benign 0.31
R7185:Pibf1 UTSW 14 99107316 missense possibly damaging 0.80
R7201:Pibf1 UTSW 14 99196408 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCTCAACATTTCTGAAACAGTG -3'
(R):5'- GCCTTGTTGTAATTAGCCATCAAAG -3'

Sequencing Primer
(F):5'- AACATTTCTGAAACAGTGTTTTTAGG -3'
(R):5'- ACTATGAAGAAAGAGGTCTCAAAAAC -3'
Posted On2016-03-17