Incidental Mutation 'R4874:Prkaa1'
ID 376793
Institutional Source Beutler Lab
Gene Symbol Prkaa1
Ensembl Gene ENSMUSG00000050697
Gene Name protein kinase, AMP-activated, alpha 1 catalytic subunit
Synonyms C130083N04Rik, AMPKalpha1
MMRRC Submission 042484-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4874 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 5143861-5181899 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5174357 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 249 (N249S)
Ref Sequence ENSEMBL: ENSMUSP00000063166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051186] [ENSMUST00000228218]
AlphaFold Q5EG47
Predicted Effect probably benign
Transcript: ENSMUST00000051186
AA Change: N249S

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000063166
Gene: ENSMUSG00000050697
AA Change: N249S

DomainStartEndE-ValueType
S_TKc 27 279 2.23e-103 SMART
low complexity region 305 318 N/A INTRINSIC
Pfam:AdenylateSensor 406 503 1.3e-15 PFAM
low complexity region 516 535 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150079
Predicted Effect probably benign
Transcript: ENSMUST00000228218
AA Change: N240S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ser/thr protein kinase family. It is the catalytic subunit of the 5'-prime-AMP-activated protein kinase (AMPK). AMPK is a cellular energy sensor conserved in all eukaryotic cells. The kinase activity of AMPK is activated by the stimuli that increase the cellular AMP/ATP ratio. AMPK regulates the activities of a number of key metabolic enzymes through phosphorylation. It protects cells from stresses that cause ATP depletion by switching off ATP-consuming biosynthetic pathways. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased muscle cell glucose uptake. Mice homozygous for a different knock-out allele exhibit anemia, reticulocytosis, splenomegaly, increased erythrocyte turnover, and elevated plasma erythropoietin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,536,183 noncoding transcript Het
Aadat G A 8: 60,516,113 probably null Het
Adamtsl1 A G 4: 86,342,492 N988S possibly damaging Het
Aph1b A T 9: 66,790,596 probably null Het
B4galnt3 C A 6: 120,207,206 R880L probably damaging Het
Bcam T C 7: 19,769,322 probably benign Het
Cr2 A T 1: 195,176,570 I14N possibly damaging Het
Dcdc5 T C 2: 106,368,106 noncoding transcript Het
Dll1 A T 17: 15,370,239 M405K probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ern2 T C 7: 122,176,587 D428G probably benign Het
Esp36 A T 17: 38,417,096 M98K unknown Het
Foxd2 G T 4: 114,907,571 H417Q possibly damaging Het
Glrb T C 3: 80,851,042 N304D possibly damaging Het
Haus3 A G 5: 34,167,628 V229A probably benign Het
Hpgd A T 8: 56,317,803 I159F possibly damaging Het
Ighv1-22 T A 12: 114,746,416 I70F probably benign Het
Il16 A T 7: 83,660,945 F584L possibly damaging Het
Lamc2 T C 1: 153,154,395 D167G probably null Het
Megf10 G A 18: 57,293,858 V1083I probably benign Het
Mertk T C 2: 128,750,159 S268P probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mki67 T C 7: 135,708,771 D132G probably damaging Het
Nbas A G 12: 13,321,755 N419D probably damaging Het
Negr1 T C 3: 156,859,445 L56S probably damaging Het
Nup214 A G 2: 31,980,584 probably null Het
Olfr1094 T A 2: 86,829,254 H167Q probably damaging Het
Olfr16 A G 1: 172,957,599 E268G probably benign Het
Olfr707 C T 7: 106,891,435 V225I probably benign Het
Opn5 C G 17: 42,580,719 A276P probably damaging Het
Papln G T 12: 83,777,143 V499L probably benign Het
Pgap1 A T 1: 54,530,137 W357R probably damaging Het
Pibf1 T C 14: 99,140,556 Y373H probably damaging Het
Pitpnm1 T C 19: 4,112,252 probably null Het
Prcd T A 11: 116,659,771 W3R probably null Het
Reg3b T A 6: 78,372,826 N116K possibly damaging Het
Rpusd2 T C 2: 119,034,879 L19P probably benign Het
Rufy1 T C 11: 50,406,450 T392A possibly damaging Het
Sall3 T C 18: 80,973,973 K247E probably benign Het
Shank1 C T 7: 44,316,073 T191M unknown Het
Slit1 C T 19: 41,729,054 probably null Het
Sorl1 A T 9: 42,063,752 V520E probably damaging Het
Vmn2r115 T A 17: 23,359,851 F766Y probably damaging Het
Zfp644 A G 5: 106,635,413 S1032P probably damaging Het
Other mutations in Prkaa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Prkaa1 APN 15 5174318 missense probably damaging 1.00
IGL01797:Prkaa1 APN 15 5168706 missense probably damaging 1.00
IGL02442:Prkaa1 APN 15 5176888 missense probably damaging 1.00
IGL02890:Prkaa1 APN 15 5177086 missense possibly damaging 0.91
IGL03146:Prkaa1 APN 15 5168641 missense probably damaging 0.99
IGL03396:Prkaa1 APN 15 5176650 missense probably damaging 1.00
pressor UTSW 15 5176956 missense probably damaging 1.00
R1439:Prkaa1 UTSW 15 5164744 missense probably damaging 0.99
R1466:Prkaa1 UTSW 15 5178798 missense probably benign
R1466:Prkaa1 UTSW 15 5178798 missense probably benign
R1804:Prkaa1 UTSW 15 5178778 missense probably benign 0.41
R1807:Prkaa1 UTSW 15 5143954 missense probably damaging 1.00
R4381:Prkaa1 UTSW 15 5176808 missense probably benign
R4398:Prkaa1 UTSW 15 5177161 missense possibly damaging 0.58
R4579:Prkaa1 UTSW 15 5160601 critical splice acceptor site probably null
R4689:Prkaa1 UTSW 15 5178696 missense probably benign
R4832:Prkaa1 UTSW 15 5160620 missense probably damaging 0.96
R4876:Prkaa1 UTSW 15 5174405 missense probably benign 0.44
R5074:Prkaa1 UTSW 15 5176911 missense possibly damaging 0.82
R5260:Prkaa1 UTSW 15 5160668 missense probably damaging 1.00
R5563:Prkaa1 UTSW 15 5169956 missense probably damaging 1.00
R5706:Prkaa1 UTSW 15 5174342 missense probably benign 0.01
R6363:Prkaa1 UTSW 15 5176956 missense probably damaging 1.00
R6825:Prkaa1 UTSW 15 5143950 missense possibly damaging 0.91
R7090:Prkaa1 UTSW 15 5177130 missense probably benign
R7921:Prkaa1 UTSW 15 5177151 missense probably damaging 1.00
R7989:Prkaa1 UTSW 15 5176685 missense probably damaging 1.00
R8289:Prkaa1 UTSW 15 5177082 missense possibly damaging 0.88
R8314:Prkaa1 UTSW 15 5178873 missense probably damaging 0.98
R9183:Prkaa1 UTSW 15 5176488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAGAGTGTTGACCGATGC -3'
(R):5'- CTGGTATCTAGAGACTCGAAAAGGTAG -3'

Sequencing Primer
(F):5'- AAGAGTGTTGACCGATGCTTTTTG -3'
(R):5'- TGCTGTGCAATGGTAATACCACG -3'
Posted On 2016-03-17