Mutagenetix > Incidental Mutation

Incidental Mutation 'R4874:Prkaa1'

376793

Institutional Source

Beutler Lab

Gene Symbol

Prkaa1

Ensembl Gene

ENSMUSG00000050697

Gene Name

protein kinase, AMP-activated, alpha 1 catalytic subunit

Synonyms

C130083N04Rik, AMPKalpha1

MMRRC Submission

042484-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4874 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5143861-5181899 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 5174357 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 249 (N249S)

Ref Sequence

ENSEMBL: ENSMUSP00000063166 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051186] [ENSMUST00000228218]

AlphaFold

Q5EG47

Predicted Effect

probably benign
Transcript: ENSMUST00000051186
AA Change: N249S

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000063166
Gene: ENSMUSG00000050697
AA Change: N249S

Domain	Start	End	E-Value	Type
S_TKc	27	279	2.23e-103	SMART
low complexity region	305	318	N/A	INTRINSIC
Pfam:AdenylateSensor	406	503	1.3e-15	PFAM
low complexity region	516	535	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150079

Predicted Effect

probably benign
Transcript: ENSMUST00000228218
AA Change: N240S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Meta Mutation Damage Score

0.0726

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

94% (51/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ser/thr protein kinase family. It is the catalytic subunit of the 5'-prime-AMP-activated protein kinase (AMPK). AMPK is a cellular energy sensor conserved in all eukaryotic cells. The kinase activity of AMPK is activated by the stimuli that increase the cellular AMP/ATP ratio. AMPK regulates the activities of a number of key metabolic enzymes through phosphorylation. It protects cells from stresses that cause ATP depletion by switching off ATP-consuming biosynthetic pathways. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased muscle cell glucose uptake. Mice homozygous for a different knock-out allele exhibit anemia, reticulocytosis, splenomegaly, increased erythrocyte turnover, and elevated plasma erythropoietin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	A	G	7: 29,536,183		noncoding transcript	Het
Aadat	G	A	8: 60,516,113		probably null	Het
Adamtsl1	A	G	4: 86,342,492	N988S	possibly damaging	Het
Aph1b	A	T	9: 66,790,596		probably null	Het
B4galnt3	C	A	6: 120,207,206	R880L	probably damaging	Het
Bcam	T	C	7: 19,769,322		probably benign	Het
Cr2	A	T	1: 195,176,570	I14N	possibly damaging	Het
Dcdc5	T	C	2: 106,368,106		noncoding transcript	Het
Dll1	A	T	17: 15,370,239	M405K	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ern2	T	C	7: 122,176,587	D428G	probably benign	Het
Esp36	A	T	17: 38,417,096	M98K	unknown	Het
Foxd2	G	T	4: 114,907,571	H417Q	possibly damaging	Het
Glrb	T	C	3: 80,851,042	N304D	possibly damaging	Het
Haus3	A	G	5: 34,167,628	V229A	probably benign	Het
Hpgd	A	T	8: 56,317,803	I159F	possibly damaging	Het
Ighv1-22	T	A	12: 114,746,416	I70F	probably benign	Het
Il16	A	T	7: 83,660,945	F584L	possibly damaging	Het
Lamc2	T	C	1: 153,154,395	D167G	probably null	Het
Megf10	G	A	18: 57,293,858	V1083I	probably benign	Het
Mertk	T	C	2: 128,750,159	S268P	probably damaging	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Mki67	T	C	7: 135,708,771	D132G	probably damaging	Het
Nbas	A	G	12: 13,321,755	N419D	probably damaging	Het
Negr1	T	C	3: 156,859,445	L56S	probably damaging	Het
Nup214	A	G	2: 31,980,584		probably null	Het
Olfr1094	T	A	2: 86,829,254	H167Q	probably damaging	Het
Olfr16	A	G	1: 172,957,599	E268G	probably benign	Het
Olfr707	C	T	7: 106,891,435	V225I	probably benign	Het
Opn5	C	G	17: 42,580,719	A276P	probably damaging	Het
Papln	G	T	12: 83,777,143	V499L	probably benign	Het
Pgap1	A	T	1: 54,530,137	W357R	probably damaging	Het
Pibf1	T	C	14: 99,140,556	Y373H	probably damaging	Het
Pitpnm1	T	C	19: 4,112,252		probably null	Het
Prcd	T	A	11: 116,659,771	W3R	probably null	Het
Reg3b	T	A	6: 78,372,826	N116K	possibly damaging	Het
Rpusd2	T	C	2: 119,034,879	L19P	probably benign	Het
Rufy1	T	C	11: 50,406,450	T392A	possibly damaging	Het
Sall3	T	C	18: 80,973,973	K247E	probably benign	Het
Shank1	C	T	7: 44,316,073	T191M	unknown	Het
Slit1	C	T	19: 41,729,054		probably null	Het
Sorl1	A	T	9: 42,063,752	V520E	probably damaging	Het
Vmn2r115	T	A	17: 23,359,851	F766Y	probably damaging	Het
Zfp644	A	G	5: 106,635,413	S1032P	probably damaging	Het

Other mutations in Prkaa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01100:Prkaa1	APN	15	5174318	missense	probably damaging	1.00
IGL01797:Prkaa1	APN	15	5168706	missense	probably damaging	1.00
IGL02442:Prkaa1	APN	15	5176888	missense	probably damaging	1.00
IGL02890:Prkaa1	APN	15	5177086	missense	possibly damaging	0.91
IGL03146:Prkaa1	APN	15	5168641	missense	probably damaging	0.99
IGL03396:Prkaa1	APN	15	5176650	missense	probably damaging	1.00
pressor	UTSW	15	5176956	missense	probably damaging	1.00
R1439:Prkaa1	UTSW	15	5164744	missense	probably damaging	0.99
R1466:Prkaa1	UTSW	15	5178798	missense	probably benign
R1466:Prkaa1	UTSW	15	5178798	missense	probably benign
R1804:Prkaa1	UTSW	15	5178778	missense	probably benign	0.41
R1807:Prkaa1	UTSW	15	5143954	missense	probably damaging	1.00
R4381:Prkaa1	UTSW	15	5176808	missense	probably benign
R4398:Prkaa1	UTSW	15	5177161	missense	possibly damaging	0.58
R4579:Prkaa1	UTSW	15	5160601	critical splice acceptor site	probably null
R4689:Prkaa1	UTSW	15	5178696	missense	probably benign
R4832:Prkaa1	UTSW	15	5160620	missense	probably damaging	0.96
R4876:Prkaa1	UTSW	15	5174405	missense	probably benign	0.44
R5074:Prkaa1	UTSW	15	5176911	missense	possibly damaging	0.82
R5260:Prkaa1	UTSW	15	5160668	missense	probably damaging	1.00
R5563:Prkaa1	UTSW	15	5169956	missense	probably damaging	1.00
R5706:Prkaa1	UTSW	15	5174342	missense	probably benign	0.01
R6363:Prkaa1	UTSW	15	5176956	missense	probably damaging	1.00
R6825:Prkaa1	UTSW	15	5143950	missense	possibly damaging	0.91
R7090:Prkaa1	UTSW	15	5177130	missense	probably benign
R7921:Prkaa1	UTSW	15	5177151	missense	probably damaging	1.00
R7989:Prkaa1	UTSW	15	5176685	missense	probably damaging	1.00
R8289:Prkaa1	UTSW	15	5177082	missense	possibly damaging	0.88
R8314:Prkaa1	UTSW	15	5178873	missense	probably damaging	0.98
R9183:Prkaa1	UTSW	15	5176488	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGAAGAGTGTTGACCGATGC -3'
(R):5'- CTGGTATCTAGAGACTCGAAAAGGTAG -3'

Sequencing Primer
(F):5'- AAGAGTGTTGACCGATGCTTTTTG -3'
(R):5'- TGCTGTGCAATGGTAATACCACG -3'

Posted On

2016-03-17