Incidental Mutation 'R4873:Tpx2'
ID376809
Institutional Source Beutler Lab
Gene Symbol Tpx2
Ensembl Gene ENSMUSG00000027469
Gene NameTPX2, microtubule-associated
SynonymsDIL2, p100, REPP86
MMRRC Submission 042483-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4873 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152847964-152895321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 152893615 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 721 (A721E)
Ref Sequence ENSEMBL: ENSMUSP00000136457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028969] [ENSMUST00000109816] [ENSMUST00000164120] [ENSMUST00000178997]
Predicted Effect probably benign
Transcript: ENSMUST00000028969
AA Change: A721E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000028969
Gene: ENSMUSG00000027469
AA Change: A721E

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 7.4e-39 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 360 541 1e-62 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 6.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109816
AA Change: A721E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105441
Gene: ENSMUSG00000027469
AA Change: A721E

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 7.4e-39 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 360 541 1e-62 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 6.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164120
AA Change: A721E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000128888
Gene: ENSMUSG00000027469
AA Change: A721E

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 5.2e-40 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 362 489 2.7e-35 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 7.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178997
AA Change: A721E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000136457
Gene: ENSMUSG00000027469
AA Change: A721E

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 5.2e-40 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 362 489 2.7e-35 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 7.5e-15 PFAM
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic arrest at the morula stage, embryonic lethality and tetraploidy of cultured E1.5 embryos. Mice heterozygous for the gene trap allele exhibit aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak1 A T 2: 32,631,177 E119D probably benign Het
Alox5 A T 6: 116,413,850 probably null Het
Atad5 T C 11: 80,120,689 V1294A probably damaging Het
BB019430 A G 10: 58,704,043 noncoding transcript Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Catsperb A T 12: 101,587,985 N646I possibly damaging Het
Ccdc112 A G 18: 46,296,289 I114T probably damaging Het
Cecr2 T C 6: 120,750,916 L340P probably damaging Het
Ces2e T A 8: 104,927,185 V85E probably damaging Het
Cnpy2 C A 10: 128,326,095 T79K probably damaging Het
Cntn4 G A 6: 106,437,913 R135H possibly damaging Het
Cyp3a16 C A 5: 145,452,849 M235I probably benign Het
Dll3 A G 7: 28,296,435 C314R probably damaging Het
Dnah7c A G 1: 46,688,925 N2928D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dqx1 C A 6: 83,061,012 D460E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ehbp1 A G 11: 22,101,164 C438R probably damaging Het
Ehd3 T G 17: 73,805,304 V21G probably damaging Het
Ero1lb G A 13: 12,604,436 V440I probably damaging Het
Fpgt G A 3: 155,087,913 A159V probably damaging Het
Gcn1l1 T C 5: 115,576,170 L123P possibly damaging Het
Gm14496 A T 2: 181,997,433 R439W probably damaging Het
Gm20767 T C 13: 120,154,670 V15A probably damaging Het
Gm4353 G C 7: 116,084,413 P49R probably damaging Het
Gsdmc2 C T 15: 63,828,252 A224T probably benign Het
Hnf1a T C 5: 114,970,673 T58A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcns1 T C 2: 164,168,101 Y246C probably damaging Het
Kif26b A G 1: 178,915,327 E549G probably benign Het
Krt9 T C 11: 100,190,037 I330V probably benign Het
Lair1 A T 7: 4,029,034 S25T probably benign Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Luzp2 A G 7: 55,167,248 I149V possibly damaging Het
Mcoln1 T A 8: 3,507,422 S143T probably benign Het
Mcph1 A G 8: 18,625,558 probably null Het
Mgat5 G A 1: 127,469,249 V578M probably damaging Het
Mis18bp1 G A 12: 65,161,435 T168M probably benign Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myom1 T C 17: 71,072,119 V626A probably damaging Het
Nat6 C T 9: 107,583,619 R238C probably damaging Het
Ncam1 T C 9: 49,507,621 probably benign Het
Nlrp2 A T 7: 5,298,859 F211L probably benign Het
Olfr1368 T A 13: 21,142,280 Y259F probably damaging Het
Olfr1495 T A 19: 13,768,762 M140K probably damaging Het
Olfr517 A T 7: 108,868,786 F123I probably damaging Het
Osbpl11 G A 16: 33,234,493 V649I probably benign Het
Oscar A T 7: 3,616,017 probably null Het
Pax8 T A 2: 24,441,640 M144L probably benign Het
Pcnt T C 10: 76,369,854 T2555A probably benign Het
Plat T A 8: 22,768,450 I23K probably benign Het
Plpp2 G A 10: 79,530,929 T51M probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Prl7c1 T C 13: 27,773,759 M233V probably benign Het
Prox1 A C 1: 190,162,122 F42C probably damaging Het
Pwwp2b A T 7: 139,256,062 Q473L possibly damaging Het
Rims4 A T 2: 163,865,523 N127K probably null Het
Scn1a T C 2: 66,328,476 T367A possibly damaging Het
Slc23a2 A G 2: 132,056,880 I579T possibly damaging Het
Sp9 T C 2: 73,273,618 V172A possibly damaging Het
Spta1 T A 1: 174,175,830 L109Q probably damaging Het
Synj2 A T 17: 5,988,068 probably benign Het
Tnrc18 A T 5: 142,765,177 M1216K unknown Het
Tpst2 T A 5: 112,309,821 Y69* probably null Het
Trmt1l A G 1: 151,455,004 T591A probably benign Het
Tubgcp4 T A 2: 121,184,849 probably benign Het
Ubiad1 T C 4: 148,444,099 T118A possibly damaging Het
Unc13c T C 9: 73,517,284 T2017A probably damaging Het
Vmn1r59 G T 7: 5,454,109 N217K probably benign Het
Vmn2r87 T C 10: 130,472,498 I624V probably damaging Het
Wdr4 A G 17: 31,499,155 V315A probably benign Het
Xpo7 T C 14: 70,676,816 probably null Het
Zfp827 T A 8: 79,060,774 W190R probably damaging Het
Zfp971 A G 2: 178,033,147 T180A probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Tpx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Tpx2 APN 2 152893591 missense probably damaging 1.00
IGL01810:Tpx2 APN 2 152884235 missense probably damaging 1.00
IGL01951:Tpx2 APN 2 152884176 missense probably benign 0.01
IGL02184:Tpx2 APN 2 152882320 nonsense probably null
IGL02422:Tpx2 APN 2 152873144 missense probably benign 0.00
IGL02441:Tpx2 APN 2 152882287 missense possibly damaging 0.88
reddened UTSW 2 152869724 missense probably benign 0.00
shamed UTSW 2 152873104 missense probably benign
R0063:Tpx2 UTSW 2 152880123 missense probably damaging 0.99
R0076:Tpx2 UTSW 2 152893683 missense probably damaging 1.00
R0271:Tpx2 UTSW 2 152867367 splice site probably benign
R0311:Tpx2 UTSW 2 152890492 missense probably damaging 0.98
R0617:Tpx2 UTSW 2 152873138 missense probably benign 0.01
R1871:Tpx2 UTSW 2 152893603 missense probably damaging 1.00
R1882:Tpx2 UTSW 2 152869691 missense probably benign
R1990:Tpx2 UTSW 2 152890624 missense probably benign
R1991:Tpx2 UTSW 2 152890624 missense probably benign
R1992:Tpx2 UTSW 2 152890624 missense probably benign
R4686:Tpx2 UTSW 2 152889183 missense possibly damaging 0.62
R4712:Tpx2 UTSW 2 152885038 missense probably damaging 1.00
R4792:Tpx2 UTSW 2 152885096 missense probably damaging 0.98
R4875:Tpx2 UTSW 2 152893615 missense probably benign 0.00
R4991:Tpx2 UTSW 2 152869724 missense probably benign 0.00
R5178:Tpx2 UTSW 2 152875549 missense probably benign 0.01
R5757:Tpx2 UTSW 2 152885231 splice site probably null
R6158:Tpx2 UTSW 2 152873104 missense probably benign
R6225:Tpx2 UTSW 2 152876628 missense probably benign
R6539:Tpx2 UTSW 2 152876598 nonsense probably null
R6633:Tpx2 UTSW 2 152867354 missense probably damaging 1.00
R7358:Tpx2 UTSW 2 152876630 missense probably benign
X0023:Tpx2 UTSW 2 152885028 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CACCTGCTTGGGCTTCATAC -3'
(R):5'- TAAAGTCTAAATGAGTGGAGGCTC -3'

Sequencing Primer
(F):5'- ACCTGCTTGGGCTTCATACTTCTC -3'
(R):5'- GCTCATTAGCTTCAAAGTTGCTG -3'
Posted On2016-03-17