Mutagenetix > Incidental Mutation

Incidental Mutation 'R4873:Nlrp2'

376819

Institutional Source

Beutler Lab

Gene Symbol

Nlrp2

Ensembl Gene

ENSMUSG00000035177

Gene Name

NLR family, pyrin domain containing 2

Synonyms

Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2

MMRRC Submission

042483-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4873 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5298547-5351035 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 5298859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 211 (F211L)

Ref Sequence

ENSEMBL: ENSMUSP00000147102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045022] [ENSMUST00000207520] [ENSMUST00000207685]

AlphaFold

Q4PLS0

Predicted Effect

probably benign
Transcript: ENSMUST00000045022
AA Change: F1006L

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: F1006L

Domain	Start	End	E-Value	Type
PYRIN	7	90	2.88e-17	SMART
Pfam:NACHT	180	348	6.9e-30	PFAM
internal_repeat_1	676	722	1.74e-5	PROSPERO
LRR	796	823	1.26e1	SMART
LRR	825	852	1.18e1	SMART
LRR	853	880	5.81e-2	SMART
LRR	882	909	3.39e-3	SMART
LRR	910	937	5.06e-2	SMART
LRR	939	966	5.23e0	SMART
LRR	967	994	3.58e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207520
AA Change: F211L

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000207685

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak1	A	T	2: 32,631,177	E119D	probably benign	Het
Alox5	A	T	6: 116,413,850		probably null	Het
Atad5	T	C	11: 80,120,689	V1294A	probably damaging	Het
BB019430	A	G	10: 58,704,043		noncoding transcript	Het
Bbs9	T	C	9: 22,578,715	F261L	probably benign	Het
Catsperb	A	T	12: 101,587,985	N646I	possibly damaging	Het
Ccdc112	A	G	18: 46,296,289	I114T	probably damaging	Het
Cecr2	T	C	6: 120,750,916	L340P	probably damaging	Het
Ces2e	T	A	8: 104,927,185	V85E	probably damaging	Het
Cnpy2	C	A	10: 128,326,095	T79K	probably damaging	Het
Cntn4	G	A	6: 106,437,913	R135H	possibly damaging	Het
Cyp3a16	C	A	5: 145,452,849	M235I	probably benign	Het
Dll3	A	G	7: 28,296,435	C314R	probably damaging	Het
Dnah7c	A	G	1: 46,688,925	N2928D	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dqx1	C	A	6: 83,061,012	D460E	probably benign	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ehbp1	A	G	11: 22,101,164	C438R	probably damaging	Het
Ehd3	T	G	17: 73,805,304	V21G	probably damaging	Het
Ero1lb	G	A	13: 12,604,436	V440I	probably damaging	Het
Fpgt	G	A	3: 155,087,913	A159V	probably damaging	Het
Gcn1l1	T	C	5: 115,576,170	L123P	possibly damaging	Het
Gm14496	A	T	2: 181,997,433	R439W	probably damaging	Het
Gm20767	T	C	13: 120,154,670	V15A	probably damaging	Het
Gm4353	G	C	7: 116,084,413	P49R	probably damaging	Het
Gsdmc2	C	T	15: 63,828,252	A224T	probably benign	Het
Hnf1a	T	C	5: 114,970,673	T58A	probably benign	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Kcns1	T	C	2: 164,168,101	Y246C	probably damaging	Het
Kif26b	A	G	1: 178,915,327	E549G	probably benign	Het
Krt9	T	C	11: 100,190,037	I330V	probably benign	Het
Lair1	A	T	7: 4,029,034	S25T	probably benign	Het
Lhx4	T	C	1: 155,705,267	T171A	possibly damaging	Het
Luzp2	A	G	7: 55,167,248	I149V	possibly damaging	Het
Mcoln1	T	A	8: 3,507,422	S143T	probably benign	Het
Mcph1	A	G	8: 18,625,558		probably null	Het
Mgat5	G	A	1: 127,469,249	V578M	probably damaging	Het
Mis18bp1	G	A	12: 65,161,435	T168M	probably benign	Het
Mroh2a	G	T	1: 88,254,935	R1195L	possibly damaging	Het
Myom1	T	C	17: 71,072,119	V626A	probably damaging	Het
Nat6	C	T	9: 107,583,619	R238C	probably damaging	Het
Ncam1	T	C	9: 49,507,621		probably benign	Het
Olfr1368	T	A	13: 21,142,280	Y259F	probably damaging	Het
Olfr1495	T	A	19: 13,768,762	M140K	probably damaging	Het
Olfr517	A	T	7: 108,868,786	F123I	probably damaging	Het
Osbpl11	G	A	16: 33,234,493	V649I	probably benign	Het
Oscar	A	T	7: 3,616,017		probably null	Het
Pax8	T	A	2: 24,441,640	M144L	probably benign	Het
Pcnt	T	C	10: 76,369,854	T2555A	probably benign	Het
Plat	T	A	8: 22,768,450	I23K	probably benign	Het
Plpp2	G	A	10: 79,530,929	T51M	probably damaging	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Prl7c1	T	C	13: 27,773,759	M233V	probably benign	Het
Prox1	A	C	1: 190,162,122	F42C	probably damaging	Het
Pwwp2b	A	T	7: 139,256,062	Q473L	possibly damaging	Het
Rims4	A	T	2: 163,865,523	N127K	probably null	Het
Scn1a	T	C	2: 66,328,476	T367A	possibly damaging	Het
Slc23a2	A	G	2: 132,056,880	I579T	possibly damaging	Het
Sp9	T	C	2: 73,273,618	V172A	possibly damaging	Het
Spta1	T	A	1: 174,175,830	L109Q	probably damaging	Het
Synj2	A	T	17: 5,988,068		probably benign	Het
Tnrc18	A	T	5: 142,765,177	M1216K	unknown	Het
Tpst2	T	A	5: 112,309,821	Y69*	probably null	Het
Tpx2	C	A	2: 152,893,615	A721E	probably benign	Het
Trmt1l	A	G	1: 151,455,004	T591A	probably benign	Het
Tubgcp4	T	A	2: 121,184,849		probably benign	Het
Ubiad1	T	C	4: 148,444,099	T118A	possibly damaging	Het
Unc13c	T	C	9: 73,517,284	T2017A	probably damaging	Het
Vmn1r59	G	T	7: 5,454,109	N217K	probably benign	Het
Vmn2r87	T	C	10: 130,472,498	I624V	probably damaging	Het
Wdr4	A	G	17: 31,499,155	V315A	probably benign	Het
Xpo7	T	C	14: 70,676,816		probably null	Het
Zfp827	T	A	8: 79,060,774	W190R	probably damaging	Het
Zfp971	A	G	2: 178,033,147	T180A	probably benign	Het
Zfp980	G	A	4: 145,702,083	G461S	probably benign	Het

Other mutations in Nlrp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Nlrp2	APN	7	5337548	missense	probably benign	0.00
IGL00545:Nlrp2	APN	7	5328252	missense	possibly damaging	0.89
IGL01311:Nlrp2	APN	7	5319239	missense	possibly damaging	0.92
IGL01345:Nlrp2	APN	7	5317492	missense	probably benign	0.16
IGL01583:Nlrp2	APN	7	5337770	missense	probably damaging	1.00
IGL01659:Nlrp2	APN	7	5328035	missense	probably damaging	1.00
IGL02240:Nlrp2	APN	7	5327823	missense	probably damaging	1.00
IGL02353:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02360:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02399:Nlrp2	APN	7	5328810	missense	probably damaging	1.00
IGL02441:Nlrp2	APN	7	5335567	critical splice donor site	probably null
IGL02588:Nlrp2	APN	7	5327552	nonsense	probably null
IGL02803:Nlrp2	APN	7	5328318	missense	probably damaging	1.00
IGL02968:Nlrp2	APN	7	5301025	missense	possibly damaging	0.81
IGL03342:Nlrp2	APN	7	5317483	missense	probably damaging	1.00
BB006:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
BB016:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R0027:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R0051:Nlrp2	UTSW	7	5322334	unclassified	probably benign
R0079:Nlrp2	UTSW	7	5327730	missense	possibly damaging	0.81
R0130:Nlrp2	UTSW	7	5322418	missense	possibly damaging	0.77
R0157:Nlrp2	UTSW	7	5308770	missense	possibly damaging	0.88
R0201:Nlrp2	UTSW	7	5328329	missense	probably benign	0.00
R0276:Nlrp2	UTSW	7	5328109	missense	probably benign	0.00
R0288:Nlrp2	UTSW	7	5328545	missense	probably benign	0.19
R0332:Nlrp2	UTSW	7	5317630	missense	probably damaging	1.00
R0724:Nlrp2	UTSW	7	5319222	missense	probably damaging	1.00
R1241:Nlrp2	UTSW	7	5328431	missense	probably damaging	1.00
R1355:Nlrp2	UTSW	7	5327491	missense	possibly damaging	0.81
R1392:Nlrp2	UTSW	7	5329015	splice site	probably benign
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1563:Nlrp2	UTSW	7	5308725	missense	probably damaging	1.00
R1866:Nlrp2	UTSW	7	5327716	nonsense	probably null
R1942:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R1959:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1960:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1961:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R2072:Nlrp2	UTSW	7	5325006	missense	probably damaging	1.00
R2161:Nlrp2	UTSW	7	5325042	missense	probably damaging	1.00
R2190:Nlrp2	UTSW	7	5319238	missense	possibly damaging	0.95
R2243:Nlrp2	UTSW	7	5335598	missense	probably benign	0.03
R2277:Nlrp2	UTSW	7	5328129	missense	probably benign
R2334:Nlrp2	UTSW	7	5337535	missense	probably benign	0.39
R3030:Nlrp2	UTSW	7	5327748	missense	probably damaging	1.00
R3404:Nlrp2	UTSW	7	5319287	missense	probably benign	0.01
R3941:Nlrp2	UTSW	7	5327552	nonsense	probably null
R4021:Nlrp2	UTSW	7	5325012	missense	probably benign	0.40
R4518:Nlrp2	UTSW	7	5325056	missense	possibly damaging	0.85
R4666:Nlrp2	UTSW	7	5319189	missense	probably benign	0.18
R4767:Nlrp2	UTSW	7	5328024	missense	probably damaging	1.00
R4827:Nlrp2	UTSW	7	5328951	missense	possibly damaging	0.60
R4875:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R5020:Nlrp2	UTSW	7	5328077	missense	probably damaging	1.00
R5293:Nlrp2	UTSW	7	5327615	missense	probably damaging	1.00
R5310:Nlrp2	UTSW	7	5325008	missense	probably benign	0.00
R5336:Nlrp2	UTSW	7	5328119	missense	probably benign
R5390:Nlrp2	UTSW	7	5300909	missense	probably benign	0.00
R5864:Nlrp2	UTSW	7	5322381	missense	probably damaging	1.00
R5913:Nlrp2	UTSW	7	5324903	splice site	probably null
R6173:Nlrp2	UTSW	7	5337809	missense	probably damaging	0.96
R6274:Nlrp2	UTSW	7	5317555	missense	probably damaging	1.00
R6303:Nlrp2	UTSW	7	5337761	missense	probably damaging	1.00
R6343:Nlrp2	UTSW	7	5300926	missense	possibly damaging	0.82
R6704:Nlrp2	UTSW	7	5325041	nonsense	probably null
R6814:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R6872:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R7023:Nlrp2	UTSW	7	5328229	nonsense	probably null
R7028:Nlrp2	UTSW	7	5328572	missense	possibly damaging	0.93
R7109:Nlrp2	UTSW	7	5328617	missense	probably damaging	1.00
R7203:Nlrp2	UTSW	7	5317534	missense	probably damaging	1.00
R7322:Nlrp2	UTSW	7	5308645	missense	possibly damaging	0.94
R7339:Nlrp2	UTSW	7	5327628	missense	possibly damaging	0.95
R7573:Nlrp2	UTSW	7	5317469	critical splice donor site	probably null
R7657:Nlrp2	UTSW	7	5319168	missense	probably benign	0.01
R7929:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R7964:Nlrp2	UTSW	7	5328528	missense	probably damaging	1.00
R8097:Nlrp2	UTSW	7	5327651	missense	probably damaging	1.00
R8276:Nlrp2	UTSW	7	5317495	missense	probably benign	0.40
R8785:Nlrp2	UTSW	7	5327549	missense	probably damaging	0.99
R8798:Nlrp2	UTSW	7	5327888	missense	possibly damaging	0.86
R8982:Nlrp2	UTSW	7	5324979	missense	probably damaging	1.00
R9030:Nlrp2	UTSW	7	5322458	missense	probably null	0.00
R9038:Nlrp2	UTSW	7	5327479	missense	probably benign	0.14
R9149:Nlrp2	UTSW	7	5327573	missense	probably benign	0.01
R9229:Nlrp2	UTSW	7	5301053	missense	possibly damaging	0.81
R9584:Nlrp2	UTSW	7	5319216	missense	probably damaging	1.00
X0027:Nlrp2	UTSW	7	5327642	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CCAATAAATCAGAGAGGGTGCCC -3'
(R):5'- CTTCTATATACAGCCACAGGGG -3'

Sequencing Primer
(F):5'- TGCCCAGAGAGTCTTCACC -3'
(R):5'- AGCCACAGGGGTGTATTCCAC -3'

Posted On

2016-03-17