Incidental Mutation 'R4873:Nlrp2'
ID 376819
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene Name NLR family, pyrin domain containing 2
Synonyms Pan1, Nbs1, E330007A02Rik, PYPAF2, Nalp2
MMRRC Submission 042483-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4873 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 5301546-5354034 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 5301858 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 211 (F211L)
Ref Sequence ENSEMBL: ENSMUSP00000147102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022] [ENSMUST00000207520] [ENSMUST00000207685]
AlphaFold Q4PLS0
Predicted Effect probably benign
Transcript: ENSMUST00000045022
AA Change: F1006L

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: F1006L

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207520
AA Change: F211L

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000207685
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak1 A T 2: 32,521,189 (GRCm39) E119D probably benign Het
Alox5 A T 6: 116,390,811 (GRCm39) probably null Het
Atad5 T C 11: 80,011,515 (GRCm39) V1294A probably damaging Het
BB019430 A G 10: 58,539,865 (GRCm39) noncoding transcript Het
Bbs9 T C 9: 22,490,011 (GRCm39) F261L probably benign Het
Catsperb A T 12: 101,554,244 (GRCm39) N646I possibly damaging Het
Ccdc112 A G 18: 46,429,356 (GRCm39) I114T probably damaging Het
Cecr2 T C 6: 120,727,877 (GRCm39) L340P probably damaging Het
Ces2e T A 8: 105,653,817 (GRCm39) V85E probably damaging Het
Cnpy2 C A 10: 128,161,964 (GRCm39) T79K probably damaging Het
Cntn4 G A 6: 106,414,874 (GRCm39) R135H possibly damaging Het
Cyp3a16 C A 5: 145,389,659 (GRCm39) M235I probably benign Het
Dll3 A G 7: 27,995,860 (GRCm39) C314R probably damaging Het
Dnah7c A G 1: 46,728,085 (GRCm39) N2928D probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dqx1 C A 6: 83,037,993 (GRCm39) D460E probably benign Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Ehbp1 A G 11: 22,051,164 (GRCm39) C438R probably damaging Het
Ehd3 T G 17: 74,112,299 (GRCm39) V21G probably damaging Het
Ero1b G A 13: 12,619,325 (GRCm39) V440I probably damaging Het
Fpgt G A 3: 154,793,550 (GRCm39) A159V probably damaging Het
Gcn1 T C 5: 115,714,229 (GRCm39) L123P possibly damaging Het
Gm14496 A T 2: 181,639,226 (GRCm39) R439W probably damaging Het
Gm4353 G C 7: 115,683,648 (GRCm39) P49R probably damaging Het
Gsdmc2 C T 15: 63,700,101 (GRCm39) A224T probably benign Het
Hnf1a T C 5: 115,108,732 (GRCm39) T58A probably benign Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Kcns1 T C 2: 164,010,021 (GRCm39) Y246C probably damaging Het
Kif26b A G 1: 178,742,892 (GRCm39) E549G probably benign Het
Krt9 T C 11: 100,080,863 (GRCm39) I330V probably benign Het
Lair1 A T 7: 4,032,033 (GRCm39) S25T probably benign Het
Lhx4 T C 1: 155,581,013 (GRCm39) T171A possibly damaging Het
Luzp2 A G 7: 54,816,996 (GRCm39) I149V possibly damaging Het
Mcoln1 T A 8: 3,557,422 (GRCm39) S143T probably benign Het
Mcph1 A G 8: 18,675,574 (GRCm39) probably null Het
Mgat5 G A 1: 127,396,986 (GRCm39) V578M probably damaging Het
Mis18bp1 G A 12: 65,208,209 (GRCm39) T168M probably benign Het
Mroh2a G T 1: 88,182,657 (GRCm39) R1195L possibly damaging Het
Myom1 T C 17: 71,379,114 (GRCm39) V626A probably damaging Het
Naa80 C T 9: 107,460,818 (GRCm39) R238C probably damaging Het
Ncam1 T C 9: 49,418,921 (GRCm39) probably benign Het
Or10a49 A T 7: 108,467,993 (GRCm39) F123I probably damaging Het
Or10q12 T A 19: 13,746,126 (GRCm39) M140K probably damaging Het
Or2ad1 T A 13: 21,326,450 (GRCm39) Y259F probably damaging Het
Osbpl11 G A 16: 33,054,863 (GRCm39) V649I probably benign Het
Oscar A T 7: 3,619,016 (GRCm39) probably null Het
Pax8 T A 2: 24,331,652 (GRCm39) M144L probably benign Het
Pcnt T C 10: 76,205,688 (GRCm39) T2555A probably benign Het
Plat T A 8: 23,258,466 (GRCm39) I23K probably benign Het
Plpp2 G A 10: 79,366,763 (GRCm39) T51M probably damaging Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Prl7c1 T C 13: 27,957,742 (GRCm39) M233V probably benign Het
Prox1 A C 1: 189,894,319 (GRCm39) F42C probably damaging Het
Pwwp2b A T 7: 138,835,978 (GRCm39) Q473L possibly damaging Het
Rims4 A T 2: 163,707,443 (GRCm39) N127K probably null Het
Scn1a T C 2: 66,158,820 (GRCm39) T367A possibly damaging Het
Slc23a2 A G 2: 131,898,800 (GRCm39) I579T possibly damaging Het
Sp9 T C 2: 73,103,962 (GRCm39) V172A possibly damaging Het
Spta1 T A 1: 174,003,396 (GRCm39) L109Q probably damaging Het
Synj2 A T 17: 6,038,343 (GRCm39) probably benign Het
Tcstv2c T C 13: 120,616,206 (GRCm39) V15A probably damaging Het
Tnrc18 A T 5: 142,750,932 (GRCm39) M1216K unknown Het
Tpst2 T A 5: 112,457,687 (GRCm39) Y69* probably null Het
Tpx2 C A 2: 152,735,535 (GRCm39) A721E probably benign Het
Trmt1l A G 1: 151,330,755 (GRCm39) T591A probably benign Het
Tubgcp4 T A 2: 121,015,330 (GRCm39) probably benign Het
Ubiad1 T C 4: 148,528,556 (GRCm39) T118A possibly damaging Het
Unc13c T C 9: 73,424,566 (GRCm39) T2017A probably damaging Het
Vmn1r59 G T 7: 5,457,108 (GRCm39) N217K probably benign Het
Vmn2r87 T C 10: 130,308,367 (GRCm39) I624V probably damaging Het
Wdr4 A G 17: 31,718,129 (GRCm39) V315A probably benign Het
Xpo7 T C 14: 70,914,256 (GRCm39) probably null Het
Zfp827 T A 8: 79,787,403 (GRCm39) W190R probably damaging Het
Zfp971 A G 2: 177,674,940 (GRCm39) T180A probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5,340,547 (GRCm39) missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5,331,251 (GRCm39) missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5,322,238 (GRCm39) missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5,320,491 (GRCm39) missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5,340,769 (GRCm39) missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5,331,034 (GRCm39) missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5,330,822 (GRCm39) missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5,331,809 (GRCm39) missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5,338,566 (GRCm39) critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5,330,551 (GRCm39) nonsense probably null
IGL02803:Nlrp2 APN 7 5,331,317 (GRCm39) missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5,304,024 (GRCm39) missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5,320,482 (GRCm39) missense probably damaging 1.00
BB006:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5,325,333 (GRCm39) unclassified probably benign
R0079:Nlrp2 UTSW 7 5,330,729 (GRCm39) missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5,325,417 (GRCm39) missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5,311,769 (GRCm39) missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5,331,328 (GRCm39) missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5,331,108 (GRCm39) missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5,331,544 (GRCm39) missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5,320,629 (GRCm39) missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5,322,221 (GRCm39) missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5,331,430 (GRCm39) missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5,330,490 (GRCm39) missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5,332,014 (GRCm39) splice site probably benign
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5,311,724 (GRCm39) missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5,330,715 (GRCm39) nonsense probably null
R1942:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5,328,005 (GRCm39) missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5,328,041 (GRCm39) missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5,322,237 (GRCm39) missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5,338,597 (GRCm39) missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5,331,128 (GRCm39) missense probably benign
R2334:Nlrp2 UTSW 7 5,340,534 (GRCm39) missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5,330,747 (GRCm39) missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5,322,286 (GRCm39) missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5,330,551 (GRCm39) nonsense probably null
R4021:Nlrp2 UTSW 7 5,328,011 (GRCm39) missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5,328,055 (GRCm39) missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5,322,188 (GRCm39) missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5,331,023 (GRCm39) missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5,331,950 (GRCm39) missense possibly damaging 0.60
R4875:Nlrp2 UTSW 7 5,301,858 (GRCm39) missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5,331,076 (GRCm39) missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5,330,614 (GRCm39) missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5,328,007 (GRCm39) missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5,331,118 (GRCm39) missense probably benign
R5390:Nlrp2 UTSW 7 5,303,908 (GRCm39) missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5,325,380 (GRCm39) missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5,327,902 (GRCm39) splice site probably null
R6173:Nlrp2 UTSW 7 5,340,808 (GRCm39) missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5,320,554 (GRCm39) missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5,340,760 (GRCm39) missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5,303,925 (GRCm39) missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5,328,040 (GRCm39) nonsense probably null
R6814:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5,331,228 (GRCm39) nonsense probably null
R7028:Nlrp2 UTSW 7 5,331,571 (GRCm39) missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5,331,616 (GRCm39) missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5,320,533 (GRCm39) missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5,311,644 (GRCm39) missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5,330,627 (GRCm39) missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5,320,468 (GRCm39) critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5,322,167 (GRCm39) missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5,331,527 (GRCm39) missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5,330,650 (GRCm39) missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5,320,494 (GRCm39) missense probably benign 0.40
R8785:Nlrp2 UTSW 7 5,330,548 (GRCm39) missense probably damaging 0.99
R8798:Nlrp2 UTSW 7 5,330,887 (GRCm39) missense possibly damaging 0.86
R8982:Nlrp2 UTSW 7 5,327,978 (GRCm39) missense probably damaging 1.00
R9030:Nlrp2 UTSW 7 5,325,457 (GRCm39) missense probably null 0.00
R9038:Nlrp2 UTSW 7 5,330,478 (GRCm39) missense probably benign 0.14
R9149:Nlrp2 UTSW 7 5,330,572 (GRCm39) missense probably benign 0.01
R9229:Nlrp2 UTSW 7 5,304,052 (GRCm39) missense possibly damaging 0.81
R9584:Nlrp2 UTSW 7 5,322,215 (GRCm39) missense probably damaging 1.00
X0027:Nlrp2 UTSW 7 5,330,641 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCAATAAATCAGAGAGGGTGCCC -3'
(R):5'- CTTCTATATACAGCCACAGGGG -3'

Sequencing Primer
(F):5'- TGCCCAGAGAGTCTTCACC -3'
(R):5'- AGCCACAGGGGTGTATTCCAC -3'
Posted On 2016-03-17