Incidental Mutation 'R0295:Ttc23'
ID 37682
Institutional Source Beutler Lab
Gene Symbol Ttc23
Ensembl Gene ENSMUSG00000030555
Gene Name tetratricopeptide repeat domain 23
Synonyms 1600012K10Rik
MMRRC Submission 038512-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R0295 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 67295180-67378370 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 67319600 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032774] [ENSMUST00000107470] [ENSMUST00000107471]
AlphaFold Q8CHY7
Predicted Effect probably benign
Transcript: ENSMUST00000032774
SMART Domains Protein: ENSMUSP00000032774
Gene: ENSMUSG00000030555

DomainStartEndE-ValueType
Blast:TPR 45 78 5e-10 BLAST
SCOP:d1a17__ 50 214 6e-8 SMART
Blast:TPR 87 121 3e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Blast:TPR 186 219 1e-6 BLAST
low complexity region 310 323 N/A INTRINSIC
Blast:TPR 398 431 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107470
SMART Domains Protein: ENSMUSP00000103094
Gene: ENSMUSG00000030555

DomainStartEndE-ValueType
Blast:TPR 45 78 4e-10 BLAST
Blast:TPR 87 121 2e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Pfam:TPR_12 185 257 5.9e-10 PFAM
low complexity region 268 281 N/A INTRINSIC
Blast:TPR 356 389 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107471
SMART Domains Protein: ENSMUSP00000103095
Gene: ENSMUSG00000030555

DomainStartEndE-ValueType
Blast:TPR 45 78 4e-10 BLAST
Blast:TPR 87 121 2e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Pfam:TPR_12 185 257 5.9e-10 PFAM
low complexity region 268 281 N/A INTRINSIC
Blast:TPR 356 389 5e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153475
Predicted Effect probably benign
Transcript: ENSMUST00000208764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155024
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik G A 10: 76,290,642 (GRCm39) S127N probably damaging Het
Abcc8 T C 7: 45,767,478 (GRCm39) R953G probably benign Het
Adamtsl3 T A 7: 82,197,213 (GRCm39) probably null Het
Adh4 A G 3: 138,134,837 (GRCm39) D337G probably damaging Het
Apob T A 12: 8,052,181 (GRCm39) Y1207* probably null Het
Birc6 T C 17: 74,920,357 (GRCm39) probably benign Het
Bms1 A G 6: 118,366,298 (GRCm39) I1065T probably benign Het
Cacna1i T A 15: 80,240,412 (GRCm39) L378Q probably damaging Het
Ccdc127 C A 13: 74,504,989 (GRCm39) P179H probably damaging Het
Ccdc18 A T 5: 108,321,655 (GRCm39) K586N probably damaging Het
Cep290 A C 10: 100,373,683 (GRCm39) E1321A probably damaging Het
Cstpp1 A T 2: 91,112,939 (GRCm39) I173N probably damaging Het
Ctc1 A G 11: 68,921,414 (GRCm39) K682E possibly damaging Het
Cux1 A C 5: 136,342,066 (GRCm39) V442G probably benign Het
Dph2 A T 4: 117,748,127 (GRCm39) V150E possibly damaging Het
Etv6 A G 6: 134,243,238 (GRCm39) D331G probably benign Het
Fbxo42 A G 4: 140,927,808 (GRCm39) D696G probably damaging Het
Fbxo8 G A 8: 57,043,109 (GRCm39) D198N probably benign Het
Gria4 T C 9: 4,793,840 (GRCm39) T73A possibly damaging Het
H2aj C G 6: 136,785,602 (GRCm39) R89G probably damaging Het
Ifng G T 10: 118,277,154 (GRCm39) S32I possibly damaging Het
Ildr1 A G 16: 36,529,839 (GRCm39) probably null Het
Knl1 A C 2: 118,919,320 (GRCm39) D1824A probably damaging Het
Lamp3 A T 16: 19,519,858 (GRCm39) Y108* probably null Het
Lcp1 A G 14: 75,436,860 (GRCm39) I69V probably null Het
Lrp6 A T 6: 134,434,656 (GRCm39) V1349E probably benign Het
Lrrcc1 A T 3: 14,630,909 (GRCm39) E1009D probably benign Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Med14 G C X: 12,551,987 (GRCm39) R1223G probably damaging Het
Mesd C T 7: 83,547,073 (GRCm39) Q179* probably null Het
Myh7 A G 14: 55,222,278 (GRCm39) probably benign Het
Myo6 T C 9: 80,190,861 (GRCm39) I804T probably damaging Het
Neb T C 2: 52,174,297 (GRCm39) I1521V possibly damaging Het
Nosip T A 7: 44,726,340 (GRCm39) I249N probably damaging Het
Nostrin A C 2: 69,009,760 (GRCm39) E296A probably benign Het
Oprk1 T C 1: 5,669,073 (GRCm39) L173S possibly damaging Het
Or2n1d A T 17: 38,646,182 (GRCm39) I45F probably damaging Het
Or4k36 T A 2: 111,146,499 (GRCm39) V225D probably damaging Het
Or51v8 T C 7: 103,319,518 (GRCm39) H240R probably damaging Het
Or5p1 T G 7: 107,916,892 (GRCm39) S264A probably benign Het
Pdzd7 A G 19: 45,025,511 (GRCm39) V328A probably benign Het
Podxl2 A T 6: 88,826,660 (GRCm39) S215R probably benign Het
Prss36 T G 7: 127,535,027 (GRCm39) T418P possibly damaging Het
Ralgps2 T A 1: 156,651,555 (GRCm39) probably benign Het
Rasa2 T C 9: 96,427,863 (GRCm39) probably null Het
Rgs1 A T 1: 144,121,224 (GRCm39) I149N probably damaging Het
Rgs16 A G 1: 153,619,483 (GRCm39) E163G probably damaging Het
Rnf121 A G 7: 101,684,553 (GRCm39) F120S possibly damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slfn8 A T 11: 82,894,169 (GRCm39) Y823* probably null Het
Spdl1 A T 11: 34,704,170 (GRCm39) N554K possibly damaging Het
St6gal1 T A 16: 23,174,953 (GRCm39) probably benign Het
Tet3 G A 6: 83,346,121 (GRCm39) P1304S probably benign Het
Timm29 T C 9: 21,504,372 (GRCm39) probably null Het
Tpcn1 T A 5: 120,677,125 (GRCm39) I687F probably damaging Het
Trim46 A G 3: 89,152,420 (GRCm39) probably benign Het
Ttll6 G T 11: 96,045,540 (GRCm39) V586L probably benign Het
Ttn A T 2: 76,588,955 (GRCm39) probably benign Het
Uba3 A T 6: 97,168,544 (GRCm39) H160Q possibly damaging Het
Usp32 A G 11: 84,944,518 (GRCm39) S316P probably damaging Het
Vcan T C 13: 89,860,310 (GRCm39) I352M probably benign Het
Zcwpw1 G T 5: 137,815,734 (GRCm39) L412F probably damaging Het
Zfp292 A T 4: 34,806,281 (GRCm39) N2254K probably damaging Het
Zscan4e A G 7: 11,041,543 (GRCm39) S138P probably damaging Het
Other mutations in Ttc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02852:Ttc23 APN 7 67,316,903 (GRCm39) unclassified probably benign
IGL03257:Ttc23 APN 7 67,361,126 (GRCm39) missense probably damaging 1.00
IGL03365:Ttc23 APN 7 67,312,085 (GRCm39) utr 5 prime probably benign
IGL03404:Ttc23 APN 7 67,328,645 (GRCm39) missense probably damaging 0.99
F5770:Ttc23 UTSW 7 67,359,063 (GRCm39) splice site probably benign
PIT4445001:Ttc23 UTSW 7 67,316,961 (GRCm39) missense probably damaging 1.00
PIT4791001:Ttc23 UTSW 7 67,312,135 (GRCm39) missense probably damaging 1.00
R0316:Ttc23 UTSW 7 67,328,821 (GRCm39) critical splice donor site probably null
R0336:Ttc23 UTSW 7 67,312,231 (GRCm39) missense probably benign 0.01
R1456:Ttc23 UTSW 7 67,316,902 (GRCm39) unclassified probably benign
R1543:Ttc23 UTSW 7 67,328,743 (GRCm39) missense probably benign 0.01
R1662:Ttc23 UTSW 7 67,375,069 (GRCm39) splice site probably null
R1708:Ttc23 UTSW 7 67,316,924 (GRCm39) missense probably damaging 0.99
R1857:Ttc23 UTSW 7 67,328,821 (GRCm39) critical splice donor site probably null
R2292:Ttc23 UTSW 7 67,319,535 (GRCm39) missense probably benign 0.08
R4471:Ttc23 UTSW 7 67,319,904 (GRCm39) missense probably benign 0.37
R6036:Ttc23 UTSW 7 67,361,114 (GRCm39) missense possibly damaging 0.85
R6036:Ttc23 UTSW 7 67,361,114 (GRCm39) missense possibly damaging 0.85
R6841:Ttc23 UTSW 7 67,319,476 (GRCm39) missense possibly damaging 0.91
R7690:Ttc23 UTSW 7 67,319,918 (GRCm39) missense possibly damaging 0.76
R8305:Ttc23 UTSW 7 67,312,135 (GRCm39) missense probably damaging 0.99
R8837:Ttc23 UTSW 7 67,319,494 (GRCm39) missense probably damaging 1.00
R8902:Ttc23 UTSW 7 67,342,761 (GRCm39) missense
R9052:Ttc23 UTSW 7 67,342,687 (GRCm39) nonsense probably null
R9150:Ttc23 UTSW 7 67,375,850 (GRCm39) missense probably damaging 0.99
RF009:Ttc23 UTSW 7 67,375,777 (GRCm39) missense possibly damaging 0.61
X0021:Ttc23 UTSW 7 67,319,879 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTTGTCACTACAAGCAAAGCAG -3'
(R):5'- GCAGCATCTCCTTGGAAAGTCTCTC -3'

Sequencing Primer
(F):5'- GTGTTCCCTGGAGCTTTTCT -3'
(R):5'- GCAACGTTTTGCTTGGCT -3'
Posted On 2013-05-23