Incidental Mutation 'R0295:Ttc23'
ID37682
Institutional Source Beutler Lab
Gene Symbol Ttc23
Ensembl Gene ENSMUSG00000030555
Gene Nametetratricopeptide repeat domain 23
Synonyms
MMRRC Submission 038512-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0295 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location67647410-67762912 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 67669852 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032774] [ENSMUST00000107470] [ENSMUST00000107471]
Predicted Effect probably benign
Transcript: ENSMUST00000032774
SMART Domains Protein: ENSMUSP00000032774
Gene: ENSMUSG00000030555

DomainStartEndE-ValueType
Blast:TPR 45 78 5e-10 BLAST
SCOP:d1a17__ 50 214 6e-8 SMART
Blast:TPR 87 121 3e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Blast:TPR 186 219 1e-6 BLAST
low complexity region 310 323 N/A INTRINSIC
Blast:TPR 398 431 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107470
SMART Domains Protein: ENSMUSP00000103094
Gene: ENSMUSG00000030555

DomainStartEndE-ValueType
Blast:TPR 45 78 4e-10 BLAST
Blast:TPR 87 121 2e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Pfam:TPR_12 185 257 5.9e-10 PFAM
low complexity region 268 281 N/A INTRINSIC
Blast:TPR 356 389 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107471
SMART Domains Protein: ENSMUSP00000103095
Gene: ENSMUSG00000030555

DomainStartEndE-ValueType
Blast:TPR 45 78 4e-10 BLAST
Blast:TPR 87 121 2e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Pfam:TPR_12 185 257 5.9e-10 PFAM
low complexity region 268 281 N/A INTRINSIC
Blast:TPR 356 389 5e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155024
Predicted Effect probably benign
Transcript: ENSMUST00000208764
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,282,594 I173N probably damaging Het
2610028H24Rik G A 10: 76,454,808 S127N probably damaging Het
Abcc8 T C 7: 46,118,054 R953G probably benign Het
Adamtsl3 T A 7: 82,548,005 probably null Het
Adh4 A G 3: 138,429,076 D337G probably damaging Het
Apob T A 12: 8,002,181 Y1207* probably null Het
Birc6 T C 17: 74,613,362 probably benign Het
Bms1 A G 6: 118,389,337 I1065T probably benign Het
Cacna1i T A 15: 80,356,211 L378Q probably damaging Het
Ccdc127 C A 13: 74,356,870 P179H probably damaging Het
Ccdc18 A T 5: 108,173,789 K586N probably damaging Het
Cep290 A C 10: 100,537,821 E1321A probably damaging Het
Ctc1 A G 11: 69,030,588 K682E possibly damaging Het
Cux1 A C 5: 136,313,212 V442G probably benign Het
Dph2 A T 4: 117,890,930 V150E possibly damaging Het
Etv6 A G 6: 134,266,275 D331G probably benign Het
Fbxo42 A G 4: 141,200,497 D696G probably damaging Het
Fbxo8 G A 8: 56,590,074 D198N probably benign Het
Gria4 T C 9: 4,793,840 T73A possibly damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Ifng G T 10: 118,441,249 S32I possibly damaging Het
Ildr1 A G 16: 36,709,477 probably null Het
Knl1 A C 2: 119,088,839 D1824A probably damaging Het
Lamp3 A T 16: 19,701,108 Y108* probably null Het
Lcp1 A G 14: 75,199,420 I69V probably null Het
Lrp6 A T 6: 134,457,693 V1349E probably benign Het
Lrrcc1 A T 3: 14,565,849 E1009D probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Med14 G C X: 12,685,748 R1223G probably damaging Het
Mesd C T 7: 83,897,865 Q179* probably null Het
Myh7 A G 14: 54,984,821 probably benign Het
Myo6 T C 9: 80,283,579 I804T probably damaging Het
Neb T C 2: 52,284,285 I1521V possibly damaging Het
Nosip T A 7: 45,076,916 I249N probably damaging Het
Nostrin A C 2: 69,179,416 E296A probably benign Het
Olfr1280 T A 2: 111,316,154 V225D probably damaging Het
Olfr136 A T 17: 38,335,291 I45F probably damaging Het
Olfr491 T G 7: 108,317,685 S264A probably benign Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Oprk1 T C 1: 5,598,850 L173S possibly damaging Het
Pdzd7 A G 19: 45,037,072 V328A probably benign Het
Podxl2 A T 6: 88,849,678 S215R probably benign Het
Prss36 T G 7: 127,935,855 T418P possibly damaging Het
Ralgps2 T A 1: 156,823,985 probably benign Het
Rasa2 T C 9: 96,545,810 probably null Het
Rgs1 A T 1: 144,245,486 I149N probably damaging Het
Rgs16 A G 1: 153,743,737 E163G probably damaging Het
Rnf121 A G 7: 102,035,346 F120S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slfn8 A T 11: 83,003,343 Y823* probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
St6gal1 T A 16: 23,356,203 probably benign Het
Tet3 G A 6: 83,369,139 P1304S probably benign Het
Timm29 T C 9: 21,593,076 probably null Het
Tpcn1 T A 5: 120,539,060 I687F probably damaging Het
Trim46 A G 3: 89,245,113 probably benign Het
Ttll6 G T 11: 96,154,714 V586L probably benign Het
Ttn A T 2: 76,758,611 probably benign Het
Uba3 A T 6: 97,191,583 H160Q possibly damaging Het
Usp32 A G 11: 85,053,692 S316P probably damaging Het
Vcan T C 13: 89,712,191 I352M probably benign Het
Zcwpw1 G T 5: 137,817,472 L412F probably damaging Het
Zfp292 A T 4: 34,806,281 N2254K probably damaging Het
Zscan4e A G 7: 11,307,616 S138P probably damaging Het
Other mutations in Ttc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02852:Ttc23 APN 7 67667155 unclassified probably benign
IGL03257:Ttc23 APN 7 67711378 missense probably damaging 1.00
IGL03365:Ttc23 APN 7 67662337 utr 5 prime probably benign
IGL03404:Ttc23 APN 7 67678897 missense probably damaging 0.99
F5770:Ttc23 UTSW 7 67709315 splice site probably benign
PIT4445001:Ttc23 UTSW 7 67667213 missense probably damaging 1.00
PIT4791001:Ttc23 UTSW 7 67662387 missense probably damaging 1.00
R0316:Ttc23 UTSW 7 67679073 critical splice donor site probably null
R0336:Ttc23 UTSW 7 67662483 missense probably benign 0.01
R1456:Ttc23 UTSW 7 67667154 unclassified probably benign
R1543:Ttc23 UTSW 7 67678995 missense probably benign 0.01
R1662:Ttc23 UTSW 7 67725321 splice site probably null
R1708:Ttc23 UTSW 7 67667176 missense probably damaging 0.99
R1857:Ttc23 UTSW 7 67679073 critical splice donor site probably null
R2292:Ttc23 UTSW 7 67669787 missense probably benign 0.08
R4471:Ttc23 UTSW 7 67670156 missense probably benign 0.37
R6036:Ttc23 UTSW 7 67711366 missense possibly damaging 0.85
R6036:Ttc23 UTSW 7 67711366 missense possibly damaging 0.85
R6841:Ttc23 UTSW 7 67669728 missense possibly damaging 0.91
R7690:Ttc23 UTSW 7 67670170 missense possibly damaging 0.76
R8305:Ttc23 UTSW 7 67662387 missense probably damaging 0.99
RF009:Ttc23 UTSW 7 67726029 missense possibly damaging 0.61
X0021:Ttc23 UTSW 7 67670131 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTTGTCACTACAAGCAAAGCAG -3'
(R):5'- GCAGCATCTCCTTGGAAAGTCTCTC -3'

Sequencing Primer
(F):5'- GTGTTCCCTGGAGCTTTTCT -3'
(R):5'- GCAACGTTTTGCTTGGCT -3'
Posted On2013-05-23