Mutagenetix > Incidental Mutation

Incidental Mutation 'R0295:Adamtsl3'

37683

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl3

Ensembl Gene

ENSMUSG00000070469

Gene Name

ADAMTS-like 3

Synonyms

punctin-2, 9230119C12Rik

MMRRC Submission

038512-MU

Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0295 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82335694-82614450 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 82548005 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]

AlphaFold

G3UXC7

Predicted Effect

probably null
Transcript: ENSMUST00000173287

SMART Domains

Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	90	136	6.43e-8	SMART
TSP1	355	414	1.59e-1	SMART
TSP1	433	492	3.72e-4	SMART
TSP1	494	547	4.28e-4	SMART
TSP1	579	638	1.85e-2	SMART
TSP1	660	717	1.75e-2	SMART
TSP1	719	773	3.45e-8	SMART
TSP1	775	833	3.67e-3	SMART
TSP1	836	894	8.99e-2	SMART
IGc2	938	1002	7.59e-4	SMART
IG	1213	1296	4.87e0	SMART
IGc2	1326	1388	1.01e-13	SMART
TSP1	1441	1498	1.95e-2	SMART
TSP1	1500	1559	6.76e-2	SMART
TSP1	1616	1666	3.84e-1	SMART
Pfam:PLAC	1674	1704	2.4e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173828

SMART Domains

Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Blast:IG	22	79	1e-26	BLAST
SCOP:d1biha4	27	77	2e-5	SMART
IG	283	366	4.87e0	SMART
IGc2	396	458	1.01e-13	SMART
TSP1	511	568	1.95e-2	SMART
TSP1	570	629	6.76e-2	SMART
TSP1	686	736	3.84e-1	SMART

Meta Mutation Damage Score

0.9491

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.9%

Validation Efficiency

100% (70/70)

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	A	T	2: 91,282,594	I173N	probably damaging	Het
2610028H24Rik	G	A	10: 76,454,808	S127N	probably damaging	Het
Abcc8	T	C	7: 46,118,054	R953G	probably benign	Het
Adh4	A	G	3: 138,429,076	D337G	probably damaging	Het
Apob	T	A	12: 8,002,181	Y1207*	probably null	Het
Birc6	T	C	17: 74,613,362		probably benign	Het
Bms1	A	G	6: 118,389,337	I1065T	probably benign	Het
Cacna1i	T	A	15: 80,356,211	L378Q	probably damaging	Het
Ccdc127	C	A	13: 74,356,870	P179H	probably damaging	Het
Ccdc18	A	T	5: 108,173,789	K586N	probably damaging	Het
Cep290	A	C	10: 100,537,821	E1321A	probably damaging	Het
Ctc1	A	G	11: 69,030,588	K682E	possibly damaging	Het
Cux1	A	C	5: 136,313,212	V442G	probably benign	Het
Dph2	A	T	4: 117,890,930	V150E	possibly damaging	Het
Etv6	A	G	6: 134,266,275	D331G	probably benign	Het
Fbxo42	A	G	4: 141,200,497	D696G	probably damaging	Het
Fbxo8	G	A	8: 56,590,074	D198N	probably benign	Het
Gria4	T	C	9: 4,793,840	T73A	possibly damaging	Het
H2afj	C	G	6: 136,808,604	R89G	probably damaging	Het
Ifng	G	T	10: 118,441,249	S32I	possibly damaging	Het
Ildr1	A	G	16: 36,709,477		probably null	Het
Knl1	A	C	2: 119,088,839	D1824A	probably damaging	Het
Lamp3	A	T	16: 19,701,108	Y108*	probably null	Het
Lcp1	A	G	14: 75,199,420	I69V	probably null	Het
Lrp6	A	T	6: 134,457,693	V1349E	probably benign	Het
Lrrcc1	A	T	3: 14,565,849	E1009D	probably benign	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Med14	G	C	X: 12,685,748	R1223G	probably damaging	Het
Mesd	C	T	7: 83,897,865	Q179*	probably null	Het
Myh7	A	G	14: 54,984,821		probably benign	Het
Myo6	T	C	9: 80,283,579	I804T	probably damaging	Het
Neb	T	C	2: 52,284,285	I1521V	possibly damaging	Het
Nosip	T	A	7: 45,076,916	I249N	probably damaging	Het
Nostrin	A	C	2: 69,179,416	E296A	probably benign	Het
Olfr1280	T	A	2: 111,316,154	V225D	probably damaging	Het
Olfr136	A	T	17: 38,335,291	I45F	probably damaging	Het
Olfr491	T	G	7: 108,317,685	S264A	probably benign	Het
Olfr624	T	C	7: 103,670,311	H240R	probably damaging	Het
Oprk1	T	C	1: 5,598,850	L173S	possibly damaging	Het
Pdzd7	A	G	19: 45,037,072	V328A	probably benign	Het
Podxl2	A	T	6: 88,849,678	S215R	probably benign	Het
Prss36	T	G	7: 127,935,855	T418P	possibly damaging	Het
Ralgps2	T	A	1: 156,823,985		probably benign	Het
Rasa2	T	C	9: 96,545,810		probably null	Het
Rgs1	A	T	1: 144,245,486	I149N	probably damaging	Het
Rgs16	A	G	1: 153,743,737	E163G	probably damaging	Het
Rnf121	A	G	7: 102,035,346	F120S	possibly damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slfn8	A	T	11: 83,003,343	Y823*	probably null	Het
Spdl1	A	T	11: 34,813,343	N554K	possibly damaging	Het
St6gal1	T	A	16: 23,356,203		probably benign	Het
Tet3	G	A	6: 83,369,139	P1304S	probably benign	Het
Timm29	T	C	9: 21,593,076		probably null	Het
Tpcn1	T	A	5: 120,539,060	I687F	probably damaging	Het
Trim46	A	G	3: 89,245,113		probably benign	Het
Ttc23	T	A	7: 67,669,852		probably benign	Het
Ttll6	G	T	11: 96,154,714	V586L	probably benign	Het
Ttn	A	T	2: 76,758,611		probably benign	Het
Uba3	A	T	6: 97,191,583	H160Q	possibly damaging	Het
Usp32	A	G	11: 85,053,692	S316P	probably damaging	Het
Vcan	T	C	13: 89,712,191	I352M	probably benign	Het
Zcwpw1	G	T	5: 137,817,472	L412F	probably damaging	Het
Zfp292	A	T	4: 34,806,281	N2254K	probably damaging	Het
Zscan4e	A	G	7: 11,307,616	S138P	probably damaging	Het

Other mutations in Adamtsl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01549:Adamtsl3	APN	7	82612448	missense	probably damaging	1.00
IGL01936:Adamtsl3	APN	7	82595371	missense	possibly damaging	0.93
IGL02819:Adamtsl3	APN	7	82574121	missense	probably damaging	0.99
P0012:Adamtsl3	UTSW	7	82574257	missense	probably benign	0.27
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0180:Adamtsl3	UTSW	7	82575990	missense	probably benign	0.00
R0270:Adamtsl3	UTSW	7	82556824	missense	probably damaging	1.00
R0329:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0330:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0548:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R0611:Adamtsl3	UTSW	7	82528912	missense	probably damaging	1.00
R0671:Adamtsl3	UTSW	7	82523182	missense	probably damaging	1.00
R0711:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0845:Adamtsl3	UTSW	7	82575996	missense	probably damaging	1.00
R1119:Adamtsl3	UTSW	7	82540317	missense	probably damaging	0.96
R1458:Adamtsl3	UTSW	7	82523320	missense	probably damaging	1.00
R1644:Adamtsl3	UTSW	7	82450090	missense	possibly damaging	0.87
R1691:Adamtsl3	UTSW	7	82499606	missense	probably damaging	1.00
R1838:Adamtsl3	UTSW	7	82493373	missense	probably damaging	1.00
R2131:Adamtsl3	UTSW	7	82578594	missense	probably damaging	1.00
R2245:Adamtsl3	UTSW	7	82450100	missense	probably damaging	1.00
R2274:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2275:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2448:Adamtsl3	UTSW	7	82499748	missense	probably damaging	1.00
R3725:Adamtsl3	UTSW	7	82612404	missense	possibly damaging	0.80
R3757:Adamtsl3	UTSW	7	82337207	missense	probably benign	0.01
R3821:Adamtsl3	UTSW	7	82606479	splice site	probably benign
R4618:Adamtsl3	UTSW	7	82606520	missense	probably benign	0.41
R4842:Adamtsl3	UTSW	7	82528861	missense	probably damaging	1.00
R4887:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4888:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4925:Adamtsl3	UTSW	7	82602299	critical splice donor site	probably null
R4960:Adamtsl3	UTSW	7	82566977	missense	probably damaging	0.99
R5026:Adamtsl3	UTSW	7	82576054	missense	probably benign	0.07
R5152:Adamtsl3	UTSW	7	82574544	missense	probably benign	0.11
R5198:Adamtsl3	UTSW	7	82611798	missense	possibly damaging	0.63
R5244:Adamtsl3	UTSW	7	82598069	missense	probably benign	0.02
R5281:Adamtsl3	UTSW	7	82528934	missense	probably damaging	1.00
R5323:Adamtsl3	UTSW	7	82557061	missense	probably damaging	1.00
R5523:Adamtsl3	UTSW	7	82574442	missense	possibly damaging	0.86
R5602:Adamtsl3	UTSW	7	82557239	missense	possibly damaging	0.89
R5638:Adamtsl3	UTSW	7	82611750	missense	probably damaging	0.99
R5682:Adamtsl3	UTSW	7	82606550	missense	probably damaging	0.99
R5782:Adamtsl3	UTSW	7	82540286	splice site	probably null
R5946:Adamtsl3	UTSW	7	82576057	missense	probably damaging	0.98
R6091:Adamtsl3	UTSW	7	82465621	missense	probably damaging	1.00
R6258:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R6500:Adamtsl3	UTSW	7	82578610	missense	probably benign	0.00
R6765:Adamtsl3	UTSW	7	82567024	missense	possibly damaging	0.60
R6785:Adamtsl3	UTSW	7	82522004	missense	probably damaging	0.99
R6982:Adamtsl3	UTSW	7	82515063	missense	probably damaging	1.00
R7109:Adamtsl3	UTSW	7	82611861	missense
R7341:Adamtsl3	UTSW	7	82556874	missense	probably damaging	1.00
R7402:Adamtsl3	UTSW	7	82578617	missense	probably damaging	0.96
R7506:Adamtsl3	UTSW	7	82514978	missense	probably damaging	1.00
R7549:Adamtsl3	UTSW	7	82573909	missense	probably damaging	1.00
R7575:Adamtsl3	UTSW	7	82574548	missense	possibly damaging	0.85
R7592:Adamtsl3	UTSW	7	82337251	missense	probably benign	0.00
R7617:Adamtsl3	UTSW	7	82556846	splice site	probably null
R7654:Adamtsl3	UTSW	7	82574494	missense	probably benign
R7721:Adamtsl3	UTSW	7	82606520	missense	possibly damaging	0.62
R7784:Adamtsl3	UTSW	7	82573989	missense	probably damaging	1.00
R7858:Adamtsl3	UTSW	7	82450163	missense	probably damaging	1.00
R8109:Adamtsl3	UTSW	7	82602279	missense	possibly damaging	0.94
R8125:Adamtsl3	UTSW	7	82450333	splice site	probably null
R8211:Adamtsl3	UTSW	7	82523163	missense	probably damaging	1.00
R8348:Adamtsl3	UTSW	7	82603799	missense	possibly damaging	0.89
R8360:Adamtsl3	UTSW	7	82547979	missense	probably damaging	1.00
R8448:Adamtsl3	UTSW	7	82603799	missense	possibly damaging	0.89
R8465:Adamtsl3	UTSW	7	82598122	missense	probably benign	0.43
R8547:Adamtsl3	UTSW	7	82428413	missense	probably damaging	1.00
R8551:Adamtsl3	UTSW	7	82540470	missense	probably benign	0.34
R8558:Adamtsl3	UTSW	7	82428392	missense	possibly damaging	0.59
R8709:Adamtsl3	UTSW	7	82428434	missense	possibly damaging	0.94
R8722:Adamtsl3	UTSW	7	82595537	critical splice donor site	probably null
R8930:Adamtsl3	UTSW	7	82611861	missense
R8932:Adamtsl3	UTSW	7	82611861	missense
R9131:Adamtsl3	UTSW	7	82595514	missense	probably benign	0.00
R9169:Adamtsl3	UTSW	7	82573980	missense	probably damaging	0.99
R9272:Adamtsl3	UTSW	7	82540545	missense	probably damaging	1.00
R9276:Adamtsl3	UTSW	7	82557502	intron	probably benign
R9351:Adamtsl3	UTSW	7	82520721	missense	possibly damaging	0.94
R9352:Adamtsl3	UTSW	7	82442448	missense	probably damaging	1.00
R9749:Adamtsl3	UTSW	7	82450186	missense	probably benign	0.04
R9750:Adamtsl3	UTSW	7	82595381	missense	probably benign	0.11
RF005:Adamtsl3	UTSW	7	82612395	missense
X0003:Adamtsl3	UTSW	7	82611759	nonsense	probably null
X0063:Adamtsl3	UTSW	7	82574157	missense	probably benign	0.25
Z1088:Adamtsl3	UTSW	7	82499714	missense	probably damaging	1.00
Z1088:Adamtsl3	UTSW	7	82540325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGTGCTGGTGATGTAAAGACCCC -3'
(R):5'- TGCCCAGTTTAGTTGCCCTTGAATG -3'

Sequencing Primer
(F):5'- TGGTGATGTAAAGACCCCAGATTC -3'
(R):5'- AGTTGCCCTTGAATGGACCC -3'

Posted On

2013-05-23