Mutagenetix > Incidental Mutation

Incidental Mutation 'R4876:Plxna2'

376847

Institutional Source

Beutler Lab

Gene Symbol

Plxna2

Ensembl Gene

ENSMUSG00000026640

Gene Name

plexin A2

Synonyms

2810428A13Rik, OCT, PlexA2, Plxn2

MMRRC Submission

042485-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4876 (G1)

Quality Score

163

Status

Validated

Chromosome

Chromosomal Location

194618218-194816869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 194643775 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 6 (F6I)

Ref Sequence

ENSEMBL: ENSMUSP00000027952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027952]

AlphaFold

P70207

PDB Structure

Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000027952
AA Change: F6I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: F6I

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
Sema	50	492	1.65e-132	SMART
PSI	510	560	8e-12	SMART
PSI	655	702	6.35e-6	SMART
PSI	803	856	1.24e-8	SMART
IPT	857	952	6.36e-21	SMART
IPT	953	1038	1.02e-24	SMART
IPT	1040	1140	1.48e-21	SMART
IPT	1142	1237	8.81e-6	SMART
transmembrane domain	1238	1260	N/A	INTRINSIC
Pfam:Plexin_cytopl	1311	1864	1.9e-261	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125381

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.5%

Validation Efficiency

99% (97/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	C	T	9: 94,537,577	R100H	probably damaging	Het
4930562C15Rik	T	C	16: 4,849,672	F309S	unknown	Het
9530053A07Rik	A	T	7: 28,142,800		probably benign	Het
A630001G21Rik	C	T	1: 85,719,040	V167M	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Ano4	A	G	10: 89,112,835	F138L	probably damaging	Het
Aoc1	T	C	6: 48,906,747	V519A	possibly damaging	Het
Arhgef37	A	T	18: 61,498,239	Y558*	probably null	Het
Atxn3	T	A	12: 101,948,379	S29C	probably damaging	Het
Bbs2	T	C	8: 94,070,160		probably benign	Het
BC052040	A	C	2: 115,670,058	H159P	probably damaging	Het
Bicral	A	T	17: 46,825,576	I236N	probably damaging	Het
Cabcoco1	A	G	10: 68,541,769	V30A	probably benign	Het
Cap2	A	G	13: 46,531,021	M1V	probably null	Het
Ccdc153	T	C	9: 44,241,008	M1T	probably null	Het
Ccnf	A	T	17: 24,230,337	V489D	probably damaging	Het
Cntnap3	T	C	13: 64,787,706	T448A	probably benign	Het
Cpa4	G	A	6: 30,590,815	D371N	probably benign	Het
Csl	T	A	10: 99,758,540	Y221F	possibly damaging	Het
Dalrd3	T	C	9: 108,571,436		probably benign	Het
Dennd4a	T	A	9: 64,896,590	N1070K	probably benign	Het
Dmwd	A	T	7: 19,080,547	D374V	probably damaging	Het
Eea1	G	T	10: 95,995,613	A189S	probably benign	Het
Fasn	A	G	11: 120,812,312	V1629A	probably damaging	Het
Fndc1	T	C	17: 7,771,639	D1075G	unknown	Het
Fsip2	A	G	2: 82,974,858	N507S	possibly damaging	Het
Gabra5	T	G	7: 57,413,665	E337A	probably damaging	Het
Gsg1l	A	G	7: 125,891,669	Y288H	probably benign	Het
H2-M11	A	T	17: 36,547,509	D65V	probably benign	Het
Hmgxb3	A	T	18: 61,146,534	C736S	possibly damaging	Het
Hsd3b3	A	T	3: 98,742,644	I121N	probably damaging	Het
Ikbke	GCC	G	1: 131,275,267		probably null	Het
Il16	A	C	7: 83,673,094	S338A	probably benign	Het
Itpr1	G	A	6: 108,482,906	A2054T	probably damaging	Het
Lamp3	T	A	16: 19,655,470	I385F	probably damaging	Het
Limch1	G	A	5: 66,881,927	V66I	possibly damaging	Het
Lmod2	A	G	6: 24,604,279	R418G	probably benign	Het
Ly6g6c	A	T	17: 35,069,440	D96V	probably damaging	Het
Map2k2	G	A	10: 81,115,113	V131M	probably damaging	Het
Mapk9	T	C	11: 49,854,325	V22A	probably damaging	Het
Mettl2	T	C	11: 105,129,068	I177T	probably damaging	Het
Mob4	C	T	1: 55,152,836		probably benign	Het
Mybpc1	T	C	10: 88,522,991	I1113V	probably benign	Het
Mybpc1	A	T	10: 88,536,424	N781K	probably benign	Het
Myom1	A	G	17: 71,077,410	T707A	probably damaging	Het
Ncam2	G	A	16: 81,490,346	A383T	probably benign	Het
Nomo1	T	C	7: 46,066,491	S761P	probably damaging	Het
Nsd3	T	A	8: 25,691,134	S921T	possibly damaging	Het
Olfr268-ps1	C	G	2: 111,844,695		noncoding transcript	Het
Olfr934	A	T	9: 38,982,626	C139*	probably null	Het
Olfr985	C	T	9: 40,127,218	V248I	probably damaging	Het
Omp	A	T	7: 98,145,026	D131E	probably benign	Het
Pard3	T	C	8: 127,561,469		probably benign	Het
Parg	A	G	14: 32,271,668	T286A	probably damaging	Het
Parp1	T	A	1: 180,569,035	M1K	probably null	Het
Pclo	T	A	5: 14,811,680	S4882R	unknown	Het
Pcnx2	C	T	8: 125,772,108	E1551K	probably damaging	Het
Pcyox1l	A	G	18: 61,699,494	Y161H	probably damaging	Het
Pdzd8	A	T	19: 59,300,804	C721*	probably null	Het
Piwil4	T	C	9: 14,740,465	D90G	probably benign	Het
Plxdc2	T	A	2: 16,703,318	C306S	probably damaging	Het
Prkaa1	T	C	15: 5,174,405	M265T	probably benign	Het
Prrc2b	T	C	2: 32,214,200	V1230A	probably benign	Het
Rfx2	T	C	17: 56,784,706	E329G	probably benign	Het
Scg2	T	C	1: 79,435,919	I322M	probably damaging	Het
Scly	T	A	1: 91,320,128	N399K	probably damaging	Het
Sec23b	T	A	2: 144,586,361		probably null	Het
Sephs2	A	T	7: 127,273,047	Y291*	probably null	Het
Slc45a3	T	C	1: 131,981,547	I494T	possibly damaging	Het
Slc6a21	C	A	7: 45,280,111	Y76*	probably null	Het
Slfn14	T	A	11: 83,276,272	I806L	possibly damaging	Het
Slfn4	T	A	11: 83,187,018	S211T	probably benign	Het
Sptbn4	A	G	7: 27,372,152	V1624A	probably damaging	Het
Sugp1	T	A	8: 70,071,184	M567K	probably damaging	Het
Tmem121	A	T	12: 113,188,728	M189L	probably benign	Het
Tmem201	A	G	4: 149,722,270	S444P	probably damaging	Het
Tmem63a	T	C	1: 180,973,186	V744A	probably benign	Het
Tnrc18	G	A	5: 142,731,625	S2358F	unknown	Het
Ubash3b	A	G	9: 41,018,109	V404A	probably benign	Het
Unc13c	A	T	9: 73,749,539	C1127S	probably damaging	Het
Unc5a	T	C	13: 54,997,229	V253A	probably benign	Het
Vmn1r-ps123	C	T	13: 22,996,365		noncoding transcript	Het
Wdr74	A	G	19: 8,739,485	E253G	possibly damaging	Het
Wwox	T	C	8: 114,448,248	Y107H	probably damaging	Het
Zdhhc22	A	T	12: 86,988,238	Y147N	probably damaging	Het
Zfp131	T	C	13: 119,788,955	H44R	possibly damaging	Het
Zfp235	A	G	7: 24,140,959	T268A	probably benign	Het
Zfp280d	T	C	9: 72,298,858		probably benign	Het
Zfp358	T	C	8: 3,496,170	S251P	probably damaging	Het

Other mutations in Plxna2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Plxna2	APN	1	194644657	missense	probably damaging	1.00
IGL00332:Plxna2	APN	1	194789830	missense	probably damaging	0.98
IGL00392:Plxna2	APN	1	194800568	missense	probably damaging	1.00
IGL00432:Plxna2	APN	1	194644096	missense	probably benign	0.03
IGL00704:Plxna2	APN	1	194751461	missense	probably damaging	0.99
IGL00737:Plxna2	APN	1	194746239	splice site	probably benign
IGL01078:Plxna2	APN	1	194786693	unclassified	probably benign
IGL01354:Plxna2	APN	1	194762435	missense	probably benign	0.02
IGL01432:Plxna2	APN	1	194644318	missense	possibly damaging	0.58
IGL01459:Plxna2	APN	1	194764570	missense	probably benign	0.00
IGL01525:Plxna2	APN	1	194712311	missense	probably benign	0.00
IGL01656:Plxna2	APN	1	194790161	missense	possibly damaging	0.52
IGL01825:Plxna2	APN	1	194788902	missense	probably damaging	0.98
IGL01862:Plxna2	APN	1	194643950	missense	possibly damaging	0.87
IGL01899:Plxna2	APN	1	194751488	missense	probably damaging	1.00
IGL01996:Plxna2	APN	1	194799776	missense	probably damaging	0.99
IGL02123:Plxna2	APN	1	194794383	missense	probably damaging	1.00
IGL02226:Plxna2	APN	1	194644424	missense	probably damaging	1.00
IGL02227:Plxna2	APN	1	194752089	missense	probably damaging	1.00
IGL02415:Plxna2	APN	1	194643964	missense	probably damaging	1.00
IGL02440:Plxna2	APN	1	194746150	missense	probably benign	0.10
IGL02545:Plxna2	APN	1	194786690	unclassified	probably benign
IGL02553:Plxna2	APN	1	194751438	missense	probably benign	0.08
IGL02882:Plxna2	APN	1	194762570	missense	probably damaging	1.00
IGL02946:Plxna2	APN	1	194749309	splice site	probably benign
IGL03062:Plxna2	APN	1	194762550	missense	possibly damaging	0.72
IGL03095:Plxna2	APN	1	194801127	missense	probably damaging	1.00
IGL03293:Plxna2	APN	1	194804945	missense	probably damaging	0.99
G1Funyon:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
PIT4514001:Plxna2	UTSW	1	194794937	missense	probably benign	0.00
R0024:Plxna2	UTSW	1	194643995	missense	possibly damaging	0.57
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0217:Plxna2	UTSW	1	194644598	missense	probably damaging	1.00
R0316:Plxna2	UTSW	1	194644150	missense	probably damaging	1.00
R0440:Plxna2	UTSW	1	194644404	nonsense	probably null
R0505:Plxna2	UTSW	1	194644348	missense	possibly damaging	0.93
R0568:Plxna2	UTSW	1	194751386	missense	probably benign	0.00
R0669:Plxna2	UTSW	1	194788837	missense	probably damaging	0.99
R0674:Plxna2	UTSW	1	194649475	missense	probably benign	0.00
R0885:Plxna2	UTSW	1	194644556	missense	probably benign
R0898:Plxna2	UTSW	1	194797024	missense	probably damaging	1.00
R0940:Plxna2	UTSW	1	194800555	missense	probably benign	0.01
R1061:Plxna2	UTSW	1	194644093	missense	probably damaging	1.00
R1067:Plxna2	UTSW	1	194780510	splice site	probably null
R1222:Plxna2	UTSW	1	194800649	missense	probably damaging	1.00
R1345:Plxna2	UTSW	1	194644486	missense	probably damaging	1.00
R1363:Plxna2	UTSW	1	194804939	nonsense	probably null
R1432:Plxna2	UTSW	1	194767463	missense	probably benign	0.10
R1434:Plxna2	UTSW	1	194751540	splice site	probably benign
R1597:Plxna2	UTSW	1	194749306	splice site	probably benign
R1719:Plxna2	UTSW	1	194644370	missense	possibly damaging	0.93
R1778:Plxna2	UTSW	1	194810970	missense	probably benign	0.01
R1795:Plxna2	UTSW	1	194806303	missense	probably damaging	0.99
R1819:Plxna2	UTSW	1	194790186	missense	probably benign	0.03
R1926:Plxna2	UTSW	1	194762450	missense	probably benign	0.02
R1966:Plxna2	UTSW	1	194644700	missense	possibly damaging	0.91
R1987:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R1988:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R2034:Plxna2	UTSW	1	194780594	missense	probably benign	0.00
R2131:Plxna2	UTSW	1	194644750	missense	probably benign	0.01
R2171:Plxna2	UTSW	1	194800617	missense	probably damaging	1.00
R2217:Plxna2	UTSW	1	194797748	missense	probably damaging	1.00
R2311:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2340:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2342:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2423:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2424:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2425:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2842:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2971:Plxna2	UTSW	1	194797731	missense	probably damaging	1.00
R3236:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3731:Plxna2	UTSW	1	194788885	missense	probably benign	0.42
R3783:Plxna2	UTSW	1	194807521	missense	probably damaging	1.00
R3784:Plxna2	UTSW	1	194644617	missense	probably benign
R3787:Plxna2	UTSW	1	194643934	missense	probably benign	0.10
R3845:Plxna2	UTSW	1	194793790	missense	probably damaging	0.96
R3927:Plxna2	UTSW	1	194746157	missense	probably benign	0.02
R3930:Plxna2	UTSW	1	194794910	missense	probably benign	0.17
R3964:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3980:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4067:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4120:Plxna2	UTSW	1	194780627	missense	probably damaging	1.00
R4231:Plxna2	UTSW	1	194644454	missense	probably damaging	1.00
R4257:Plxna2	UTSW	1	194644775	missense	probably damaging	1.00
R4396:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4397:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4418:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4444:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4446:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4482:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4487:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4489:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4571:Plxna2	UTSW	1	194810988	missense	possibly damaging	0.91
R4622:Plxna2	UTSW	1	194812150	missense	probably benign
R4623:Plxna2	UTSW	1	194812150	missense	probably benign
R4684:Plxna2	UTSW	1	194762594	missense	probably benign	0.42
R4688:Plxna2	UTSW	1	194644445	missense	probably damaging	1.00
R4855:Plxna2	UTSW	1	194797732	missense	probably benign	0.39
R5161:Plxna2	UTSW	1	194751404	missense	probably benign
R5207:Plxna2	UTSW	1	194788899	missense	probably benign	0.19
R5479:Plxna2	UTSW	1	194793873	missense	probably benign
R5931:Plxna2	UTSW	1	194810870	missense	probably damaging	1.00
R6026:Plxna2	UTSW	1	194799814	missense	probably damaging	1.00
R6029:Plxna2	UTSW	1	194794427	missense	probably benign	0.00
R6029:Plxna2	UTSW	1	194799575	missense	probably damaging	1.00
R6059:Plxna2	UTSW	1	194810971	missense	possibly damaging	0.79
R6238:Plxna2	UTSW	1	194790196	missense	probably benign	0.01
R6322:Plxna2	UTSW	1	194754367	missense	possibly damaging	0.89
R6668:Plxna2	UTSW	1	194810088	missense	possibly damaging	0.68
R6709:Plxna2	UTSW	1	194789766	missense	probably benign	0.01
R6748:Plxna2	UTSW	1	194794182	splice site	probably null
R6838:Plxna2	UTSW	1	194804914	missense	possibly damaging	0.90
R6844:Plxna2	UTSW	1	194793828	missense	probably benign	0.08
R7069:Plxna2	UTSW	1	194793904	missense	possibly damaging	0.51
R7122:Plxna2	UTSW	1	194644568	nonsense	probably null
R7145:Plxna2	UTSW	1	194649522	missense	probably benign	0.31
R7189:Plxna2	UTSW	1	194801058	missense	possibly damaging	0.58
R7207:Plxna2	UTSW	1	194644019	missense	probably damaging	1.00
R7232:Plxna2	UTSW	1	194712260	missense	probably damaging	1.00
R7234:Plxna2	UTSW	1	194806390	missense	probably damaging	0.96
R7246:Plxna2	UTSW	1	194644282	missense	possibly damaging	0.74
R7255:Plxna2	UTSW	1	194752103	missense	probably benign	0.03
R7283:Plxna2	UTSW	1	194644883	missense	probably damaging	0.99
R7288:Plxna2	UTSW	1	194796919	missense	probably damaging	1.00
R7361:Plxna2	UTSW	1	194799779	missense	probably damaging	1.00
R7424:Plxna2	UTSW	1	194806339	missense	probably damaging	0.98
R7501:Plxna2	UTSW	1	194643895	missense	possibly damaging	0.95
R7528:Plxna2	UTSW	1	194812156	missense	probably damaging	1.00
R7529:Plxna2	UTSW	1	194643871	missense	probably benign	0.25
R7532:Plxna2	UTSW	1	194644819	missense	probably benign	0.13
R7959:Plxna2	UTSW	1	194793864	frame shift	probably null
R7959:Plxna2	UTSW	1	194810962	missense	probably damaging	1.00
R7960:Plxna2	UTSW	1	194793864	frame shift	probably null
R8261:Plxna2	UTSW	1	194749416	missense	probably damaging	1.00
R8301:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
R8463:Plxna2	UTSW	1	194644046	missense	probably damaging	1.00
R8519:Plxna2	UTSW	1	194793958	missense	probably damaging	1.00
R8836:Plxna2	UTSW	1	194796935	missense	possibly damaging	0.94
R9010:Plxna2	UTSW	1	194788909	missense	possibly damaging	0.95
R9034:Plxna2	UTSW	1	194793889	missense	probably damaging	1.00
R9254:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9274:Plxna2	UTSW	1	194788828	missense	probably damaging	1.00
R9379:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9385:Plxna2	UTSW	1	194749416	missense	possibly damaging	0.95
R9422:Plxna2	UTSW	1	194644422	missense	probably damaging	1.00
R9451:Plxna2	UTSW	1	194644384	missense	probably benign	0.05
R9484:Plxna2	UTSW	1	194644894	missense	probably damaging	1.00
X0027:Plxna2	UTSW	1	194644433	missense	probably damaging	1.00
Z1088:Plxna2	UTSW	1	194644441	missense	possibly damaging	0.56
Z1088:Plxna2	UTSW	1	194764539	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GATTCCCTTAGCAACCTTGGG -3'
(R):5'- GTAGACACGATTGATAGCCCC -3'

Sequencing Primer
(F):5'- TGTAGCAAAAGAAACTCATAGCAC -3'
(R):5'- CGATTGATAGCCCCCACATAC -3'

Posted On

2016-03-17