Mutagenetix > Incidental Mutation

Incidental Mutation 'R4876:Itpr1'

376860

Institutional Source

Beutler Lab

Gene Symbol

Itpr1

Ensembl Gene

ENSMUSG00000030102

Gene Name

inositol 1,4,5-trisphosphate receptor 1

Synonyms

P400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt

MMRRC Submission

042485-MU

Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Essential gene?

Probably essential (E-score: 0.752) question?

Stock #

R4876 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108213096-108551109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 108482906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 2054 (A2054T)

Ref Sequence

ENSEMBL: ENSMUSP00000144880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032192
AA Change: A2055T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: A2055T

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1758	1787	N/A	INTRINSIC
Pfam:RIH_assoc	1959	2069	1.2e-33	PFAM
transmembrane domain	2274	2296	N/A	INTRINSIC
Pfam:Ion_trans	2311	2600	9e-22	PFAM
coiled coil region	2683	2732	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000203615
AA Change: A2054T

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: A2054T

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1757	1786	N/A	INTRINSIC
Pfam:RIH_assoc	1958	2068	1.2e-33	PFAM
transmembrane domain	2273	2295	N/A	INTRINSIC
Pfam:Ion_trans	2310	2599	9e-22	PFAM
coiled coil region	2682	2731	N/A	INTRINSIC

Meta Mutation Damage Score

0.6506

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.5%

Validation Efficiency

99% (97/98)

MGI Phenotype

Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]

Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	C	T	9: 94,537,577	R100H	probably damaging	Het
4930562C15Rik	T	C	16: 4,849,672	F309S	unknown	Het
9530053A07Rik	A	T	7: 28,142,800		probably benign	Het
A630001G21Rik	C	T	1: 85,719,040	V167M	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Ano4	A	G	10: 89,112,835	F138L	probably damaging	Het
Aoc1	T	C	6: 48,906,747	V519A	possibly damaging	Het
Arhgef37	A	T	18: 61,498,239	Y558*	probably null	Het
Atxn3	T	A	12: 101,948,379	S29C	probably damaging	Het
Bbs2	T	C	8: 94,070,160		probably benign	Het
BC052040	A	C	2: 115,670,058	H159P	probably damaging	Het
Bicral	A	T	17: 46,825,576	I236N	probably damaging	Het
Cabcoco1	A	G	10: 68,541,769	V30A	probably benign	Het
Cap2	A	G	13: 46,531,021	M1V	probably null	Het
Ccdc153	T	C	9: 44,241,008	M1T	probably null	Het
Ccnf	A	T	17: 24,230,337	V489D	probably damaging	Het
Cntnap3	T	C	13: 64,787,706	T448A	probably benign	Het
Cpa4	G	A	6: 30,590,815	D371N	probably benign	Het
Csl	T	A	10: 99,758,540	Y221F	possibly damaging	Het
Dalrd3	T	C	9: 108,571,436		probably benign	Het
Dennd4a	T	A	9: 64,896,590	N1070K	probably benign	Het
Dmwd	A	T	7: 19,080,547	D374V	probably damaging	Het
Eea1	G	T	10: 95,995,613	A189S	probably benign	Het
Fasn	A	G	11: 120,812,312	V1629A	probably damaging	Het
Fndc1	T	C	17: 7,771,639	D1075G	unknown	Het
Fsip2	A	G	2: 82,974,858	N507S	possibly damaging	Het
Gabra5	T	G	7: 57,413,665	E337A	probably damaging	Het
Gsg1l	A	G	7: 125,891,669	Y288H	probably benign	Het
H2-M11	A	T	17: 36,547,509	D65V	probably benign	Het
Hmgxb3	A	T	18: 61,146,534	C736S	possibly damaging	Het
Hsd3b3	A	T	3: 98,742,644	I121N	probably damaging	Het
Ikbke	GCC	G	1: 131,275,267		probably null	Het
Il16	A	C	7: 83,673,094	S338A	probably benign	Het
Lamp3	T	A	16: 19,655,470	I385F	probably damaging	Het
Limch1	G	A	5: 66,881,927	V66I	possibly damaging	Het
Lmod2	A	G	6: 24,604,279	R418G	probably benign	Het
Ly6g6c	A	T	17: 35,069,440	D96V	probably damaging	Het
Map2k2	G	A	10: 81,115,113	V131M	probably damaging	Het
Mapk9	T	C	11: 49,854,325	V22A	probably damaging	Het
Mettl2	T	C	11: 105,129,068	I177T	probably damaging	Het
Mob4	C	T	1: 55,152,836		probably benign	Het
Mybpc1	T	C	10: 88,522,991	I1113V	probably benign	Het
Mybpc1	A	T	10: 88,536,424	N781K	probably benign	Het
Myom1	A	G	17: 71,077,410	T707A	probably damaging	Het
Ncam2	G	A	16: 81,490,346	A383T	probably benign	Het
Nomo1	T	C	7: 46,066,491	S761P	probably damaging	Het
Nsd3	T	A	8: 25,691,134	S921T	possibly damaging	Het
Olfr268-ps1	C	G	2: 111,844,695		noncoding transcript	Het
Olfr934	A	T	9: 38,982,626	C139*	probably null	Het
Olfr985	C	T	9: 40,127,218	V248I	probably damaging	Het
Omp	A	T	7: 98,145,026	D131E	probably benign	Het
Pard3	T	C	8: 127,561,469		probably benign	Het
Parg	A	G	14: 32,271,668	T286A	probably damaging	Het
Parp1	T	A	1: 180,569,035	M1K	probably null	Het
Pclo	T	A	5: 14,811,680	S4882R	unknown	Het
Pcnx2	C	T	8: 125,772,108	E1551K	probably damaging	Het
Pcyox1l	A	G	18: 61,699,494	Y161H	probably damaging	Het
Pdzd8	A	T	19: 59,300,804	C721*	probably null	Het
Piwil4	T	C	9: 14,740,465	D90G	probably benign	Het
Plxdc2	T	A	2: 16,703,318	C306S	probably damaging	Het
Plxna2	T	A	1: 194,643,775	F6I	probably benign	Het
Prkaa1	T	C	15: 5,174,405	M265T	probably benign	Het
Prrc2b	T	C	2: 32,214,200	V1230A	probably benign	Het
Rfx2	T	C	17: 56,784,706	E329G	probably benign	Het
Scg2	T	C	1: 79,435,919	I322M	probably damaging	Het
Scly	T	A	1: 91,320,128	N399K	probably damaging	Het
Sec23b	T	A	2: 144,586,361		probably null	Het
Sephs2	A	T	7: 127,273,047	Y291*	probably null	Het
Slc45a3	T	C	1: 131,981,547	I494T	possibly damaging	Het
Slc6a21	C	A	7: 45,280,111	Y76*	probably null	Het
Slfn14	T	A	11: 83,276,272	I806L	possibly damaging	Het
Slfn4	T	A	11: 83,187,018	S211T	probably benign	Het
Sptbn4	A	G	7: 27,372,152	V1624A	probably damaging	Het
Sugp1	T	A	8: 70,071,184	M567K	probably damaging	Het
Tmem121	A	T	12: 113,188,728	M189L	probably benign	Het
Tmem201	A	G	4: 149,722,270	S444P	probably damaging	Het
Tmem63a	T	C	1: 180,973,186	V744A	probably benign	Het
Tnrc18	G	A	5: 142,731,625	S2358F	unknown	Het
Ubash3b	A	G	9: 41,018,109	V404A	probably benign	Het
Unc13c	A	T	9: 73,749,539	C1127S	probably damaging	Het
Unc5a	T	C	13: 54,997,229	V253A	probably benign	Het
Vmn1r-ps123	C	T	13: 22,996,365		noncoding transcript	Het
Wdr74	A	G	19: 8,739,485	E253G	possibly damaging	Het
Wwox	T	C	8: 114,448,248	Y107H	probably damaging	Het
Zdhhc22	A	T	12: 86,988,238	Y147N	probably damaging	Het
Zfp131	T	C	13: 119,788,955	H44R	possibly damaging	Het
Zfp235	A	G	7: 24,140,959	T268A	probably benign	Het
Zfp280d	T	C	9: 72,298,858		probably benign	Het
Zfp358	T	C	8: 3,496,170	S251P	probably damaging	Het

Other mutations in Itpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Itpr1	APN	6	108471120	missense	probably damaging	0.98
IGL01073:Itpr1	APN	6	108413820	missense	probably benign	0.00
IGL01105:Itpr1	APN	6	108381333	missense	probably benign	0.00
IGL01296:Itpr1	APN	6	108399361	missense	probably damaging	1.00
IGL01325:Itpr1	APN	6	108381208	missense	probably benign	0.01
IGL01418:Itpr1	APN	6	108339624	critical splice donor site	probably null
IGL01464:Itpr1	APN	6	108386727	missense	possibly damaging	0.95
IGL01467:Itpr1	APN	6	108488496	missense	probably damaging	0.96
IGL01645:Itpr1	APN	6	108473599	missense	possibly damaging	0.91
IGL01672:Itpr1	APN	6	108381032	nonsense	probably null
IGL01969:Itpr1	APN	6	108377691	missense	probably damaging	1.00
IGL02164:Itpr1	APN	6	108389483	missense	probably benign	0.08
IGL02206:Itpr1	APN	6	108549820	missense	probably damaging	1.00
IGL02232:Itpr1	APN	6	108417923	missense	probably damaging	1.00
IGL02297:Itpr1	APN	6	108339517	missense	possibly damaging	0.84
IGL02434:Itpr1	APN	6	108489922	splice site	probably null
IGL02568:Itpr1	APN	6	108339554	missense	possibly damaging	0.82
IGL02992:Itpr1	APN	6	108381315	missense	probably damaging	1.00
IGL03109:Itpr1	APN	6	108417981	missense	probably damaging	1.00
IGL03130:Itpr1	APN	6	108523401	missense	probably benign	0.00
IGL03333:Itpr1	APN	6	108380910	unclassified	probably benign
aboriginal	UTSW	6	108515947	missense	probably benign
approximation	UTSW	6	108394841	missense	probably benign
estimate	UTSW	6	108389553	missense	probably null	1.00
icarus	UTSW	6	108410900	missense	probably damaging	1.00
marsupialized	UTSW	6	108394073	splice site	probably null
primordial	UTSW	6	108518755	missense	probably benign	0.06
roo	UTSW	6	108410867	missense	probably benign	0.00
wallaby	UTSW	6	108389387	missense	probably damaging	1.00
P0005:Itpr1	UTSW	6	108381257	missense	probably damaging	1.00
PIT4366001:Itpr1	UTSW	6	108493757	nonsense	probably null
R0019:Itpr1	UTSW	6	108354626	missense	probably damaging	1.00
R0128:Itpr1	UTSW	6	108471209	splice site	probably benign
R0129:Itpr1	UTSW	6	108349676	missense	probably damaging	1.00
R0135:Itpr1	UTSW	6	108488482	splice site	probably benign
R0244:Itpr1	UTSW	6	108473589	missense	probably benign	0.00
R0391:Itpr1	UTSW	6	108378167	missense	probably benign	0.22
R0543:Itpr1	UTSW	6	108515748	splice site	probably benign
R0647:Itpr1	UTSW	6	108383698	missense	probably damaging	1.00
R0766:Itpr1	UTSW	6	108410900	missense	probably damaging	1.00
R0971:Itpr1	UTSW	6	108349629	missense	possibly damaging	0.70
R1083:Itpr1	UTSW	6	108510696	missense	possibly damaging	0.92
R1277:Itpr1	UTSW	6	108339621	missense	probably benign	0.22
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1605:Itpr1	UTSW	6	108349659	missense	possibly damaging	0.77
R1661:Itpr1	UTSW	6	108482897	missense	probably benign	0.38
R1852:Itpr1	UTSW	6	108386706	missense	probably damaging	1.00
R1929:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2012:Itpr1	UTSW	6	108440536	missense	probably benign	0.02
R2027:Itpr1	UTSW	6	108386853	missense	possibly damaging	0.80
R2111:Itpr1	UTSW	6	108378309	unclassified	probably benign
R2166:Itpr1	UTSW	6	108388225	missense	probably damaging	1.00
R2272:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2484:Itpr1	UTSW	6	108369110	missense	probably damaging	1.00
R3115:Itpr1	UTSW	6	108406109	missense	possibly damaging	0.55
R3751:Itpr1	UTSW	6	108349680	missense	probably damaging	1.00
R3798:Itpr1	UTSW	6	108381270	missense	probably damaging	1.00
R3930:Itpr1	UTSW	6	108394841	missense	probably benign
R4081:Itpr1	UTSW	6	108391835	missense	probably damaging	1.00
R4119:Itpr1	UTSW	6	108394355	missense	probably benign
R4406:Itpr1	UTSW	6	108354663	missense	probably damaging	1.00
R4506:Itpr1	UTSW	6	108432686	missense	probably damaging	1.00
R4616:Itpr1	UTSW	6	108481223	missense	probably damaging	1.00
R4655:Itpr1	UTSW	6	108481293	missense	probably damaging	1.00
R4661:Itpr1	UTSW	6	108410931	critical splice donor site	probably null
R4760:Itpr1	UTSW	6	108349632	missense	probably benign	0.29
R4836:Itpr1	UTSW	6	108389537	missense	probably damaging	0.99
R4857:Itpr1	UTSW	6	108410867	missense	probably benign	0.00
R4939:Itpr1	UTSW	6	108440558	nonsense	probably null
R5076:Itpr1	UTSW	6	108405529	splice site	probably null
R5088:Itpr1	UTSW	6	108389387	missense	probably damaging	1.00
R5248:Itpr1	UTSW	6	108542062	missense	probably damaging	1.00
R5290:Itpr1	UTSW	6	108406145	missense	possibly damaging	0.95
R5308:Itpr1	UTSW	6	108356511	missense	probably damaging	1.00
R5339:Itpr1	UTSW	6	108393961	missense	probably damaging	1.00
R5368:Itpr1	UTSW	6	108387498	missense	probably damaging	1.00
R5369:Itpr1	UTSW	6	108519424	missense	probably damaging	0.99
R5419:Itpr1	UTSW	6	108493794	missense	possibly damaging	0.95
R5615:Itpr1	UTSW	6	108488600	missense	possibly damaging	0.71
R5779:Itpr1	UTSW	6	108352143	missense	probably damaging	1.00
R5781:Itpr1	UTSW	6	108510738	missense	probably benign	0.23
R5869:Itpr1	UTSW	6	108473529	missense	probably benign	0.30
R5903:Itpr1	UTSW	6	108489797	intron	probably benign
R5929:Itpr1	UTSW	6	108423336	missense	probably benign
R5956:Itpr1	UTSW	6	108506027	missense	probably benign	0.25
R6160:Itpr1	UTSW	6	108518755	missense	probably benign	0.06
R6163:Itpr1	UTSW	6	108388284	missense	probably damaging	1.00
R6169:Itpr1	UTSW	6	108369116	missense	probably damaging	1.00
R6237:Itpr1	UTSW	6	108378203	missense	possibly damaging	0.53
R6398:Itpr1	UTSW	6	108505903	missense	probably damaging	0.96
R6455:Itpr1	UTSW	6	108417972	missense	probably damaging	1.00
R6522:Itpr1	UTSW	6	108388276	missense	probably damaging	1.00
R6524:Itpr1	UTSW	6	108363683	missense	probably damaging	1.00
R6650:Itpr1	UTSW	6	108394073	splice site	probably null
R6806:Itpr1	UTSW	6	108515947	missense	probably benign
R6838:Itpr1	UTSW	6	108471191	missense	possibly damaging	0.87
R6841:Itpr1	UTSW	6	108388192	missense	probably damaging	1.00
R6896:Itpr1	UTSW	6	108481394	missense	probably damaging	1.00
R7014:Itpr1	UTSW	6	108431498	critical splice donor site	probably null
R7076:Itpr1	UTSW	6	108388296	missense	probably benign
R7116:Itpr1	UTSW	6	108481268	missense	probably damaging	0.99
R7152:Itpr1	UTSW	6	108394407	critical splice donor site	probably null
R7161:Itpr1	UTSW	6	108386640	missense	probably damaging	1.00
R7166:Itpr1	UTSW	6	108378190	missense	probably benign	0.06
R7241:Itpr1	UTSW	6	108517620	critical splice donor site	probably null
R7301:Itpr1	UTSW	6	108542024	missense	possibly damaging	0.86
R7330:Itpr1	UTSW	6	108438331	missense	probably benign	0.28
R7449:Itpr1	UTSW	6	108389384	missense	probably damaging	0.98
R7472:Itpr1	UTSW	6	108403396	missense	probably benign	0.05
R7502:Itpr1	UTSW	6	108383678	missense	probably benign	0.00
R7779:Itpr1	UTSW	6	108523348	missense	possibly damaging	0.75
R7828:Itpr1	UTSW	6	108482931	missense	probably damaging	1.00
R7854:Itpr1	UTSW	6	108387369	missense	probably damaging	1.00
R7974:Itpr1	UTSW	6	108523405	missense	possibly damaging	0.86
R7998:Itpr1	UTSW	6	108417948	missense	possibly damaging	0.88
R8039:Itpr1	UTSW	6	108386628	missense	probably damaging	1.00
R8136:Itpr1	UTSW	6	108438360	missense	probably benign	0.18
R8200:Itpr1	UTSW	6	108394865	missense	probably benign	0.00
R8242:Itpr1	UTSW	6	108386697	missense	probably benign	0.44
R8322:Itpr1	UTSW	6	108388229	missense	probably benign	0.05
R8377:Itpr1	UTSW	6	108510738	missense	probably benign	0.00
R8412:Itpr1	UTSW	6	108363620	missense	probably benign	0.07
R8443:Itpr1	UTSW	6	108519348	missense	probably damaging	0.99
R8669:Itpr1	UTSW	6	108393967	missense	probably damaging	0.99
R8697:Itpr1	UTSW	6	108523366	missense	probably damaging	1.00
R8744:Itpr1	UTSW	6	108377802	missense	possibly damaging	0.79
R8870:Itpr1	UTSW	6	108388211	missense	probably damaging	1.00
R8921:Itpr1	UTSW	6	108378198	missense	possibly damaging	0.87
R8961:Itpr1	UTSW	6	108493705	missense	possibly damaging	0.86
R9095:Itpr1	UTSW	6	108387391	missense	probably benign	0.02
R9205:Itpr1	UTSW	6	108489849	missense	probably damaging	0.99
R9282:Itpr1	UTSW	6	108394023	missense	probably damaging	1.00
R9323:Itpr1	UTSW	6	108352018	missense	probably damaging	1.00
R9376:Itpr1	UTSW	6	108349677	missense	probably damaging	0.99
R9392:Itpr1	UTSW	6	108413876	missense	probably benign
R9428:Itpr1	UTSW	6	108401347	missense	possibly damaging	0.84
R9621:Itpr1	UTSW	6	108416909	missense	probably damaging	1.00
R9632:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9646:Itpr1	UTSW	6	108394884	missense	probably damaging	1.00
R9695:Itpr1	UTSW	6	108401350	missense	probably damaging	1.00
R9710:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9721:Itpr1	UTSW	6	108406102	missense	probably damaging	0.96
R9780:Itpr1	UTSW	6	108510834	missense	probably benign	0.03
Z1176:Itpr1	UTSW	6	108499149	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGGGACTTTCCTACTGTTTACTG -3'
(R):5'- TGTCACATGCCAGGTAAAGC -3'

Sequencing Primer
(F):5'- TCTGAAACTAGAGATCTTCATCTGTC -3'
(R):5'- TGCCAGGTAAAGCATACATTGAC -3'

Posted On

2016-03-17