Incidental Mutation 'R4876:Sptbn4'
ID 376864
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Name spectrin beta, non-erythrocytic 4
Synonyms nmf261, 1700022P15Rik, SpbIV, ROSA62, 5830426A08Rik, dyn, neuroaxonal dystrophy, Spnb4
MMRRC Submission 042485-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.379) question?
Stock # R4876 (G1)
Quality Score 111
Status Validated
Chromosome 7
Chromosomal Location 27055808-27147111 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27071577 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1624 (V1624A)
Ref Sequence ENSEMBL: ENSMUSP00000132807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]
AlphaFold E9PX29
Predicted Effect probably damaging
Transcript: ENSMUST00000011895
AA Change: V1629A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: V1629A

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108362
AA Change: V309A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: V309A

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108363
AA Change: V309A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: V309A

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108364
AA Change: V309A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: V309A

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172269
AA Change: V1624A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: V1624A

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Meta Mutation Damage Score 0.1125 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,536 (GRCm39) F309S unknown Het
A630001G21Rik C T 1: 85,646,761 (GRCm39) V167M probably damaging Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Ano4 A G 10: 88,948,697 (GRCm39) F138L probably damaging Het
Aoc1 T C 6: 48,883,681 (GRCm39) V519A possibly damaging Het
Arhgef37 A T 18: 61,631,310 (GRCm39) Y558* probably null Het
Atxn3 T A 12: 101,914,638 (GRCm39) S29C probably damaging Het
Bbs2 T C 8: 94,796,788 (GRCm39) probably benign Het
Bicral A T 17: 47,136,502 (GRCm39) I236N probably damaging Het
Cabcoco1 A G 10: 68,377,599 (GRCm39) V30A probably benign Het
Cap2 A G 13: 46,684,497 (GRCm39) M1V probably null Het
Ccdc153 T C 9: 44,152,305 (GRCm39) M1T probably null Het
Ccnf A T 17: 24,449,311 (GRCm39) V489D probably damaging Het
Cdin1 A C 2: 115,500,539 (GRCm39) H159P probably damaging Het
Cntnap3 T C 13: 64,935,520 (GRCm39) T448A probably benign Het
Cpa4 G A 6: 30,590,814 (GRCm39) D371N probably benign Het
Csl T A 10: 99,594,402 (GRCm39) Y221F possibly damaging Het
Dalrd3 T C 9: 108,448,635 (GRCm39) probably benign Het
Dennd4a T A 9: 64,803,872 (GRCm39) N1070K probably benign Het
Dipk2a C T 9: 94,419,630 (GRCm39) R100H probably damaging Het
Dmwd A T 7: 18,814,472 (GRCm39) D374V probably damaging Het
Eea1 G T 10: 95,831,475 (GRCm39) A189S probably benign Het
Fasn A G 11: 120,703,138 (GRCm39) V1629A probably damaging Het
Fcgbpl1 A T 7: 27,842,225 (GRCm39) probably benign Het
Fndc1 T C 17: 7,990,471 (GRCm39) D1075G unknown Het
Fsip2 A G 2: 82,805,202 (GRCm39) N507S possibly damaging Het
Gabra5 T G 7: 57,063,413 (GRCm39) E337A probably damaging Het
Gsg1l A G 7: 125,490,841 (GRCm39) Y288H probably benign Het
H2-M11 A T 17: 36,858,401 (GRCm39) D65V probably benign Het
Hmgxb3 A T 18: 61,279,606 (GRCm39) C736S possibly damaging Het
Hsd3b3 A T 3: 98,649,960 (GRCm39) I121N probably damaging Het
Ikbke GCC G 1: 131,203,004 (GRCm39) probably null Het
Il16 A C 7: 83,322,302 (GRCm39) S338A probably benign Het
Itpr1 G A 6: 108,459,867 (GRCm39) A2054T probably damaging Het
Lamp3 T A 16: 19,474,220 (GRCm39) I385F probably damaging Het
Limch1 G A 5: 67,039,270 (GRCm39) V66I possibly damaging Het
Lmod2 A G 6: 24,604,278 (GRCm39) R418G probably benign Het
Ly6g6c A T 17: 35,288,416 (GRCm39) D96V probably damaging Het
Map2k2 G A 10: 80,950,947 (GRCm39) V131M probably damaging Het
Mapk9 T C 11: 49,745,152 (GRCm39) V22A probably damaging Het
Mettl2 T C 11: 105,019,894 (GRCm39) I177T probably damaging Het
Mob4 C T 1: 55,191,995 (GRCm39) probably benign Het
Mybpc1 A T 10: 88,372,286 (GRCm39) N781K probably benign Het
Mybpc1 T C 10: 88,358,853 (GRCm39) I1113V probably benign Het
Myom1 A G 17: 71,384,405 (GRCm39) T707A probably damaging Het
Ncam2 G A 16: 81,287,234 (GRCm39) A383T probably benign Het
Nomo1 T C 7: 45,715,915 (GRCm39) S761P probably damaging Het
Nsd3 T A 8: 26,181,161 (GRCm39) S921T possibly damaging Het
Omp A T 7: 97,794,233 (GRCm39) D131E probably benign Het
Or10d1c A T 9: 38,893,922 (GRCm39) C139* probably null Het
Or4f7d-ps1 C G 2: 111,675,040 (GRCm39) noncoding transcript Het
Or8d4 C T 9: 40,038,514 (GRCm39) V248I probably damaging Het
Pard3 T C 8: 128,287,950 (GRCm39) probably benign Het
Parg A G 14: 31,993,625 (GRCm39) T286A probably damaging Het
Parp1 T A 1: 180,396,600 (GRCm39) M1K probably null Het
Pclo T A 5: 14,861,694 (GRCm39) S4882R unknown Het
Pcnx2 C T 8: 126,498,847 (GRCm39) E1551K probably damaging Het
Pcyox1l A G 18: 61,832,565 (GRCm39) Y161H probably damaging Het
Pdzd8 A T 19: 59,289,236 (GRCm39) C721* probably null Het
Piwil4 T C 9: 14,651,761 (GRCm39) D90G probably benign Het
Plxdc2 T A 2: 16,708,129 (GRCm39) C306S probably damaging Het
Plxna2 T A 1: 194,326,083 (GRCm39) F6I probably benign Het
Prkaa1 T C 15: 5,203,886 (GRCm39) M265T probably benign Het
Prrc2b T C 2: 32,104,212 (GRCm39) V1230A probably benign Het
Rfx2 T C 17: 57,091,706 (GRCm39) E329G probably benign Het
Scg2 T C 1: 79,413,636 (GRCm39) I322M probably damaging Het
Scly T A 1: 91,247,850 (GRCm39) N399K probably damaging Het
Sec23b T A 2: 144,428,281 (GRCm39) probably null Het
Sephs2 A T 7: 126,872,219 (GRCm39) Y291* probably null Het
Slc45a3 T C 1: 131,909,285 (GRCm39) I494T possibly damaging Het
Slc6a21 C A 7: 44,929,535 (GRCm39) Y76* probably null Het
Slfn14 T A 11: 83,167,098 (GRCm39) I806L possibly damaging Het
Slfn4 T A 11: 83,077,844 (GRCm39) S211T probably benign Het
Sugp1 T A 8: 70,523,834 (GRCm39) M567K probably damaging Het
Tmem121 A T 12: 113,152,348 (GRCm39) M189L probably benign Het
Tmem201 A G 4: 149,806,727 (GRCm39) S444P probably damaging Het
Tmem63a T C 1: 180,800,751 (GRCm39) V744A probably benign Het
Tnrc18 G A 5: 142,717,380 (GRCm39) S2358F unknown Het
Ubash3b A G 9: 40,929,405 (GRCm39) V404A probably benign Het
Unc13c A T 9: 73,656,821 (GRCm39) C1127S probably damaging Het
Unc5a T C 13: 55,145,042 (GRCm39) V253A probably benign Het
Vmn1r-ps123 C T 13: 23,180,535 (GRCm39) noncoding transcript Het
Wdr74 A G 19: 8,716,849 (GRCm39) E253G possibly damaging Het
Wwox T C 8: 115,174,988 (GRCm39) Y107H probably damaging Het
Zdhhc22 A T 12: 87,035,012 (GRCm39) Y147N probably damaging Het
Zfp131 T C 13: 120,250,491 (GRCm39) H44R possibly damaging Het
Zfp235 A G 7: 23,840,384 (GRCm39) T268A probably benign Het
Zfp280d T C 9: 72,206,140 (GRCm39) probably benign Het
Zfp358 T C 8: 3,546,170 (GRCm39) S251P probably damaging Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27,068,859 (GRCm39) missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27,117,390 (GRCm39) missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27,114,196 (GRCm39) missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27,103,693 (GRCm39) missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27,063,571 (GRCm39) missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27,063,940 (GRCm39) missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27,063,782 (GRCm39) missense probably benign
IGL02226:Sptbn4 APN 7 27,065,132 (GRCm39) missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27,063,724 (GRCm39) missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27,127,672 (GRCm39) missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27,065,014 (GRCm39) missense probably null 0.15
IGL02487:Sptbn4 APN 7 27,118,522 (GRCm39) missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27,090,976 (GRCm39) missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27,067,104 (GRCm39) missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27,126,258 (GRCm39) missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27,126,258 (GRCm39) missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27,093,573 (GRCm39) splice site probably benign
IGL02961:Sptbn4 APN 7 27,097,392 (GRCm39) missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27,056,812 (GRCm39) nonsense probably null
R0194:Sptbn4 UTSW 7 27,104,336 (GRCm39) missense probably benign 0.00
R0328:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27,059,161 (GRCm39) splice site probably benign
R0510:Sptbn4 UTSW 7 27,060,991 (GRCm39) critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27,063,803 (GRCm39) missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27,107,753 (GRCm39) nonsense probably null
R1336:Sptbn4 UTSW 7 27,117,388 (GRCm39) missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27,133,719 (GRCm39) missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27,118,164 (GRCm39) missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27,118,008 (GRCm39) missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27,066,071 (GRCm39) missense probably null 0.96
R1906:Sptbn4 UTSW 7 27,090,856 (GRCm39) critical splice donor site probably null
R1924:Sptbn4 UTSW 7 27,106,563 (GRCm39) missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27,065,868 (GRCm39) missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27,067,127 (GRCm39) missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27,123,235 (GRCm39) missense probably benign 0.19
R2005:Sptbn4 UTSW 7 27,065,844 (GRCm39) nonsense probably null
R2083:Sptbn4 UTSW 7 27,127,681 (GRCm39) missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27,063,587 (GRCm39) missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27,067,034 (GRCm39) missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27,133,782 (GRCm39) missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27,133,782 (GRCm39) missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27,059,517 (GRCm39) missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27,117,523 (GRCm39) nonsense probably null
R4115:Sptbn4 UTSW 7 27,090,995 (GRCm39) missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27,090,995 (GRCm39) missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27,117,896 (GRCm39) missense probably damaging 0.97
R4426:Sptbn4 UTSW 7 27,123,223 (GRCm39) missense probably damaging 1.00
R4535:Sptbn4 UTSW 7 27,067,127 (GRCm39) missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27,066,160 (GRCm39) missense possibly damaging 0.60
R4684:Sptbn4 UTSW 7 27,063,844 (GRCm39) missense probably damaging 0.96
R4707:Sptbn4 UTSW 7 27,116,431 (GRCm39) missense probably benign 0.12
R5091:Sptbn4 UTSW 7 27,068,816 (GRCm39) missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27,059,166 (GRCm39) critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27,065,853 (GRCm39) missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27,118,138 (GRCm39) missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27,103,678 (GRCm39) missense probably benign 0.00
R5980:Sptbn4 UTSW 7 27,071,596 (GRCm39) missense probably damaging 1.00
R6005:Sptbn4 UTSW 7 27,118,024 (GRCm39) missense probably damaging 1.00
R6013:Sptbn4 UTSW 7 27,063,904 (GRCm39) missense probably damaging 0.99
R6037:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27,059,513 (GRCm39) missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27,064,012 (GRCm39) nonsense probably null
R6762:Sptbn4 UTSW 7 27,093,633 (GRCm39) missense probably damaging 1.00
R6897:Sptbn4 UTSW 7 27,071,375 (GRCm39) missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27,117,481 (GRCm39) missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27,116,210 (GRCm39) missense probably benign 0.44
R7465:Sptbn4 UTSW 7 27,066,114 (GRCm39) missense probably benign 0.00
R7471:Sptbn4 UTSW 7 27,108,439 (GRCm39) missense possibly damaging 0.64
R7510:Sptbn4 UTSW 7 27,127,693 (GRCm39) missense probably benign 0.13
R7527:Sptbn4 UTSW 7 27,075,015 (GRCm39) missense possibly damaging 0.94
R7528:Sptbn4 UTSW 7 27,141,960 (GRCm39) missense probably benign 0.00
R7572:Sptbn4 UTSW 7 27,071,697 (GRCm39) missense probably damaging 0.99
R7649:Sptbn4 UTSW 7 27,061,002 (GRCm39) missense possibly damaging 0.80
R7714:Sptbn4 UTSW 7 27,063,761 (GRCm39) missense probably benign 0.02
R7780:Sptbn4 UTSW 7 27,061,059 (GRCm39) missense possibly damaging 0.70
R7854:Sptbn4 UTSW 7 27,061,835 (GRCm39) missense probably benign
R8002:Sptbn4 UTSW 7 27,117,417 (GRCm39) missense possibly damaging 0.91
R8058:Sptbn4 UTSW 7 27,063,694 (GRCm39) missense possibly damaging 0.92
R8181:Sptbn4 UTSW 7 27,074,808 (GRCm39) missense possibly damaging 0.79
R8195:Sptbn4 UTSW 7 27,108,314 (GRCm39) nonsense probably null
R8353:Sptbn4 UTSW 7 27,103,663 (GRCm39) missense probably damaging 1.00
R8392:Sptbn4 UTSW 7 27,071,721 (GRCm39) missense probably damaging 1.00
R8453:Sptbn4 UTSW 7 27,103,663 (GRCm39) missense probably damaging 1.00
R8815:Sptbn4 UTSW 7 27,106,657 (GRCm39) nonsense probably null
R8818:Sptbn4 UTSW 7 27,063,592 (GRCm39) missense possibly damaging 0.71
R9171:Sptbn4 UTSW 7 27,141,844 (GRCm39) missense possibly damaging 0.95
R9259:Sptbn4 UTSW 7 27,067,124 (GRCm39) missense possibly damaging 0.74
R9477:Sptbn4 UTSW 7 27,132,624 (GRCm39) missense possibly damaging 0.79
R9564:Sptbn4 UTSW 7 27,117,504 (GRCm39) missense probably damaging 0.98
R9572:Sptbn4 UTSW 7 27,066,095 (GRCm39) missense probably benign 0.16
R9623:Sptbn4 UTSW 7 27,107,807 (GRCm39) missense probably damaging 1.00
R9715:Sptbn4 UTSW 7 27,091,000 (GRCm39) missense probably damaging 1.00
R9782:Sptbn4 UTSW 7 27,107,993 (GRCm39) missense probably benign 0.02
R9790:Sptbn4 UTSW 7 27,071,662 (GRCm39) missense probably damaging 0.99
R9791:Sptbn4 UTSW 7 27,071,662 (GRCm39) missense probably damaging 0.99
R9798:Sptbn4 UTSW 7 27,056,717 (GRCm39) makesense probably null
X0020:Sptbn4 UTSW 7 27,102,159 (GRCm39) critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27,056,736 (GRCm39) unclassified probably benign
Z1176:Sptbn4 UTSW 7 27,059,450 (GRCm39) missense probably damaging 0.99
Z1177:Sptbn4 UTSW 7 27,108,527 (GRCm39) missense probably benign 0.41
Z1177:Sptbn4 UTSW 7 27,104,007 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCAGTTGTAAATGCTTCTTGAG -3'
(R):5'- ACCCGATGTCTCATTCGCAG -3'

Sequencing Primer
(F):5'- CTTCTTGAGCAGCTGCAGG -3'
(R):5'- ATGTCTCATTCGCAGGGCCTG -3'
Posted On 2016-03-17