Incidental Mutation 'R4876:9530053A07Rik'
ID 376865
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene Name RIKEN cDNA 9530053A07 gene
Synonyms
MMRRC Submission 042485-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R4876 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 28129466-28164811 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to T at 28142800 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
AlphaFold E9PVG8
Predicted Effect probably benign
Transcript: ENSMUST00000059886
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130693
Predicted Effect probably benign
Transcript: ENSMUST00000150948
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 99% (97/98)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,537,577 R100H probably damaging Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
A630001G21Rik C T 1: 85,719,040 V167M probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano4 A G 10: 89,112,835 F138L probably damaging Het
Aoc1 T C 6: 48,906,747 V519A possibly damaging Het
Arhgef37 A T 18: 61,498,239 Y558* probably null Het
Atxn3 T A 12: 101,948,379 S29C probably damaging Het
Bbs2 T C 8: 94,070,160 probably benign Het
BC052040 A C 2: 115,670,058 H159P probably damaging Het
Bicral A T 17: 46,825,576 I236N probably damaging Het
Cabcoco1 A G 10: 68,541,769 V30A probably benign Het
Cap2 A G 13: 46,531,021 M1V probably null Het
Ccdc153 T C 9: 44,241,008 M1T probably null Het
Ccnf A T 17: 24,230,337 V489D probably damaging Het
Cntnap3 T C 13: 64,787,706 T448A probably benign Het
Cpa4 G A 6: 30,590,815 D371N probably benign Het
Csl T A 10: 99,758,540 Y221F possibly damaging Het
Dalrd3 T C 9: 108,571,436 probably benign Het
Dennd4a T A 9: 64,896,590 N1070K probably benign Het
Dmwd A T 7: 19,080,547 D374V probably damaging Het
Eea1 G T 10: 95,995,613 A189S probably benign Het
Fasn A G 11: 120,812,312 V1629A probably damaging Het
Fndc1 T C 17: 7,771,639 D1075G unknown Het
Fsip2 A G 2: 82,974,858 N507S possibly damaging Het
Gabra5 T G 7: 57,413,665 E337A probably damaging Het
Gsg1l A G 7: 125,891,669 Y288H probably benign Het
H2-M11 A T 17: 36,547,509 D65V probably benign Het
Hmgxb3 A T 18: 61,146,534 C736S possibly damaging Het
Hsd3b3 A T 3: 98,742,644 I121N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Il16 A C 7: 83,673,094 S338A probably benign Het
Itpr1 G A 6: 108,482,906 A2054T probably damaging Het
Lamp3 T A 16: 19,655,470 I385F probably damaging Het
Limch1 G A 5: 66,881,927 V66I possibly damaging Het
Lmod2 A G 6: 24,604,279 R418G probably benign Het
Ly6g6c A T 17: 35,069,440 D96V probably damaging Het
Map2k2 G A 10: 81,115,113 V131M probably damaging Het
Mapk9 T C 11: 49,854,325 V22A probably damaging Het
Mettl2 T C 11: 105,129,068 I177T probably damaging Het
Mob4 C T 1: 55,152,836 probably benign Het
Mybpc1 T C 10: 88,522,991 I1113V probably benign Het
Mybpc1 A T 10: 88,536,424 N781K probably benign Het
Myom1 A G 17: 71,077,410 T707A probably damaging Het
Ncam2 G A 16: 81,490,346 A383T probably benign Het
Nomo1 T C 7: 46,066,491 S761P probably damaging Het
Nsd3 T A 8: 25,691,134 S921T possibly damaging Het
Olfr268-ps1 C G 2: 111,844,695 noncoding transcript Het
Olfr934 A T 9: 38,982,626 C139* probably null Het
Olfr985 C T 9: 40,127,218 V248I probably damaging Het
Omp A T 7: 98,145,026 D131E probably benign Het
Pard3 T C 8: 127,561,469 probably benign Het
Parg A G 14: 32,271,668 T286A probably damaging Het
Parp1 T A 1: 180,569,035 M1K probably null Het
Pclo T A 5: 14,811,680 S4882R unknown Het
Pcnx2 C T 8: 125,772,108 E1551K probably damaging Het
Pcyox1l A G 18: 61,699,494 Y161H probably damaging Het
Pdzd8 A T 19: 59,300,804 C721* probably null Het
Piwil4 T C 9: 14,740,465 D90G probably benign Het
Plxdc2 T A 2: 16,703,318 C306S probably damaging Het
Plxna2 T A 1: 194,643,775 F6I probably benign Het
Prkaa1 T C 15: 5,174,405 M265T probably benign Het
Prrc2b T C 2: 32,214,200 V1230A probably benign Het
Rfx2 T C 17: 56,784,706 E329G probably benign Het
Scg2 T C 1: 79,435,919 I322M probably damaging Het
Scly T A 1: 91,320,128 N399K probably damaging Het
Sec23b T A 2: 144,586,361 probably null Het
Sephs2 A T 7: 127,273,047 Y291* probably null Het
Slc45a3 T C 1: 131,981,547 I494T possibly damaging Het
Slc6a21 C A 7: 45,280,111 Y76* probably null Het
Slfn14 T A 11: 83,276,272 I806L possibly damaging Het
Slfn4 T A 11: 83,187,018 S211T probably benign Het
Sptbn4 A G 7: 27,372,152 V1624A probably damaging Het
Sugp1 T A 8: 70,071,184 M567K probably damaging Het
Tmem121 A T 12: 113,188,728 M189L probably benign Het
Tmem201 A G 4: 149,722,270 S444P probably damaging Het
Tmem63a T C 1: 180,973,186 V744A probably benign Het
Tnrc18 G A 5: 142,731,625 S2358F unknown Het
Ubash3b A G 9: 41,018,109 V404A probably benign Het
Unc13c A T 9: 73,749,539 C1127S probably damaging Het
Unc5a T C 13: 54,997,229 V253A probably benign Het
Vmn1r-ps123 C T 13: 22,996,365 noncoding transcript Het
Wdr74 A G 19: 8,739,485 E253G possibly damaging Het
Wwox T C 8: 114,448,248 Y107H probably damaging Het
Zdhhc22 A T 12: 86,988,238 Y147N probably damaging Het
Zfp131 T C 13: 119,788,955 H44R possibly damaging Het
Zfp235 A G 7: 24,140,959 T268A probably benign Het
Zfp280d T C 9: 72,298,858 probably benign Het
Zfp358 T C 8: 3,496,170 S251P probably damaging Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28164528 missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28154445 missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28155318 missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28139778 missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28150702 missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28140133 missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28155324 missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28153292 missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28152796 missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28137525 missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28139856 missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28146779 nonsense probably null
IGL02219:9530053A07Rik APN 7 28154635 missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28157892 missense probably benign
IGL02804:9530053A07Rik APN 7 28153370 missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28162923 missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28147188 missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28164372 missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28153722 missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28142242 missense probably damaging 0.99
herz UTSW 7 28153839 missense possibly damaging 0.72
pulse UTSW 7 28153749 missense probably damaging 1.00
Sinusoidal UTSW 7 28140130 missense probably damaging 1.00
PIT4378001:9530053A07Rik UTSW 7 28154464 missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28153412 missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28156825 missense probably damaging 1.00
R0310:9530053A07Rik UTSW 7 28142274 missense probably benign 0.04
R0448:9530053A07Rik UTSW 7 28140235 missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28137340 missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28153749 missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28147465 missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28159378 missense probably benign
R0562:9530053A07Rik UTSW 7 28162690 missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28137091 missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28154520 missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28157673 missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28142794 splice site probably benign
R1368:9530053A07Rik UTSW 7 28159478 missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28137157 missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28157093 missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R1655:9530053A07Rik UTSW 7 28147110 missense probably damaging 0.98
R1697:9530053A07Rik UTSW 7 28154347 missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28157854 missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28155372 missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28155546 nonsense probably null
R1861:9530053A07Rik UTSW 7 28154732 missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28144348 missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28131512 missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28154360 missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28155594 missense probably benign
R2084:9530053A07Rik UTSW 7 28157535 missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28158022 missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28155474 missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28131635 missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28164307 missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28154195 missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28154555 missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28157778 missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28140038 nonsense probably null
R3938:9530053A07Rik UTSW 7 28154294 missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28152985 missense possibly damaging 0.55
R4152:9530053A07Rik UTSW 7 28156897 missense possibly damaging 0.47
R4168:9530053A07Rik UTSW 7 28137109 missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28156648 missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28154335 missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28146906 missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28152856 missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28150719 missense probably benign
R4841:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4905:9530053A07Rik UTSW 7 28156983 missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28143924 missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28156958 missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28153308 missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5396:9530053A07Rik UTSW 7 28140183 missense probably benign
R5441:9530053A07Rik UTSW 7 28156914 missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28157999 nonsense probably null
R5542:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5571:9530053A07Rik UTSW 7 28156569 missense probably damaging 0.99
R5613:9530053A07Rik UTSW 7 28142878 intron probably benign
R5637:9530053A07Rik UTSW 7 28152852 missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28137329 nonsense probably null
R6174:9530053A07Rik UTSW 7 28139959 missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28150714 missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28157592 missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28144186 missense possibly damaging 0.88
R6478:9530053A07Rik UTSW 7 28155373 missense probably damaging 1.00
R6699:9530053A07Rik UTSW 7 28144368 missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28147135 missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28152835 missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6992:9530053A07Rik UTSW 7 28140183 missense probably benign 0.04
R7023:9530053A07Rik UTSW 7 28140038 nonsense probably null
R7039:9530053A07Rik UTSW 7 28140148 missense possibly damaging 0.80
R7171:9530053A07Rik UTSW 7 28154519 nonsense probably null
R7282:9530053A07Rik UTSW 7 28144408 missense probably benign 0.02
R7291:9530053A07Rik UTSW 7 28140220 missense probably benign
R7344:9530053A07Rik UTSW 7 28140279 missense possibly damaging 0.79
R7344:9530053A07Rik UTSW 7 28152760 missense possibly damaging 0.46
R7392:9530053A07Rik UTSW 7 28164372 missense possibly damaging 0.83
R7531:9530053A07Rik UTSW 7 28140231 missense probably benign
R7541:9530053A07Rik UTSW 7 28144256 nonsense probably null
R7577:9530053A07Rik UTSW 7 28154423 missense possibly damaging 0.65
R7594:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R7647:9530053A07Rik UTSW 7 28140045 missense probably benign 0.00
R7718:9530053A07Rik UTSW 7 28147201 missense probably damaging 1.00
R7733:9530053A07Rik UTSW 7 28139965 missense probably damaging 1.00
R7737:9530053A07Rik UTSW 7 28157073 missense probably damaging 1.00
R7908:9530053A07Rik UTSW 7 28147496 missense probably benign 0.12
R8013:9530053A07Rik UTSW 7 28137541 missense probably benign 0.14
R8014:9530053A07Rik UTSW 7 28137541 missense probably benign 0.14
R8151:9530053A07Rik UTSW 7 28153341 missense possibly damaging 0.95
R8175:9530053A07Rik UTSW 7 28164448 nonsense probably null
R8254:9530053A07Rik UTSW 7 28147349 missense possibly damaging 0.63
R8345:9530053A07Rik UTSW 7 28155360 missense probably damaging 1.00
R8414:9530053A07Rik UTSW 7 28142733 missense probably damaging 1.00
R8419:9530053A07Rik UTSW 7 28143921 missense probably damaging 1.00
R8496:9530053A07Rik UTSW 7 28143952 missense possibly damaging 0.81
R8691:9530053A07Rik UTSW 7 28153839 missense possibly damaging 0.72
R8785:9530053A07Rik UTSW 7 28154707 missense probably damaging 1.00
R8863:9530053A07Rik UTSW 7 28131581 missense probably damaging 1.00
R8926:9530053A07Rik UTSW 7 28154444 missense probably damaging 1.00
R8950:9530053A07Rik UTSW 7 28164326 missense probably benign 0.32
R9014:9530053A07Rik UTSW 7 28155451 missense probably damaging 1.00
R9045:9530053A07Rik UTSW 7 28154431 missense probably damaging 1.00
R9115:9530053A07Rik UTSW 7 28154329 missense possibly damaging 0.74
R9233:9530053A07Rik UTSW 7 28140094 missense possibly damaging 0.83
R9330:9530053A07Rik UTSW 7 28156985 missense probably benign 0.02
R9426:9530053A07Rik UTSW 7 28143856 missense possibly damaging 0.92
R9477:9530053A07Rik UTSW 7 28152840 missense probably damaging 1.00
R9502:9530053A07Rik UTSW 7 28137466 missense probably benign 0.09
R9505:9530053A07Rik UTSW 7 28142484 nonsense probably null
R9601:9530053A07Rik UTSW 7 28154380 missense possibly damaging 0.78
R9630:9530053A07Rik UTSW 7 28137199 missense probably damaging 1.00
R9632:9530053A07Rik UTSW 7 28142301 missense probably benign
R9673:9530053A07Rik UTSW 7 28156619 missense probably benign 0.25
R9735:9530053A07Rik UTSW 7 28157010 missense probably damaging 1.00
Z1176:9530053A07Rik UTSW 7 28142386 missense probably benign 0.06
Z1176:9530053A07Rik UTSW 7 28154762 missense probably benign 0.03
Z1177:9530053A07Rik UTSW 7 28139898 missense probably benign 0.25
Z1186:9530053A07Rik UTSW 7 28131572 missense probably benign
Z1186:9530053A07Rik UTSW 7 28146705 missense probably benign 0.00
Z1186:9530053A07Rik UTSW 7 28156986 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGCCTGCCTACAACAGTG -3'
(R):5'- GCAGGTGGCTCTGTAAAAGC -3'

Sequencing Primer
(F):5'- TGCCTACATAGAGTGCGCCTATG -3'
(R):5'- AACATGCCATGCTTACGTCTGG -3'
Posted On 2016-03-17