Incidental Mutation 'R0295:Olfr491'
ID37687
Institutional Source Beutler Lab
Gene Symbol Olfr491
Ensembl Gene ENSMUSG00000094612
Gene Nameolfactory receptor 491
SynonymsMOR204-11, GA_x6K02T2PBJ9-10646917-10647849
MMRRC Submission 038512-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R0295 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108313451-108318827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 108317685 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 264 (S264A)
Ref Sequence ENSEMBL: ENSMUSP00000150694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053179] [ENSMUST00000209545] [ENSMUST00000214605]
Predicted Effect probably benign
Transcript: ENSMUST00000053179
AA Change: S264A

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061188
Gene: ENSMUSG00000094612
AA Change: S264A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.4e-50 PFAM
Pfam:7tm_1 41 290 5.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209545
AA Change: S264A

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000214605
AA Change: S264A

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,282,594 I173N probably damaging Het
2610028H24Rik G A 10: 76,454,808 S127N probably damaging Het
Abcc8 T C 7: 46,118,054 R953G probably benign Het
Adamtsl3 T A 7: 82,548,005 probably null Het
Adh4 A G 3: 138,429,076 D337G probably damaging Het
Apob T A 12: 8,002,181 Y1207* probably null Het
Birc6 T C 17: 74,613,362 probably benign Het
Bms1 A G 6: 118,389,337 I1065T probably benign Het
Cacna1i T A 15: 80,356,211 L378Q probably damaging Het
Ccdc127 C A 13: 74,356,870 P179H probably damaging Het
Ccdc18 A T 5: 108,173,789 K586N probably damaging Het
Cep290 A C 10: 100,537,821 E1321A probably damaging Het
Ctc1 A G 11: 69,030,588 K682E possibly damaging Het
Cux1 A C 5: 136,313,212 V442G probably benign Het
Dph2 A T 4: 117,890,930 V150E possibly damaging Het
Etv6 A G 6: 134,266,275 D331G probably benign Het
Fbxo42 A G 4: 141,200,497 D696G probably damaging Het
Fbxo8 G A 8: 56,590,074 D198N probably benign Het
Gria4 T C 9: 4,793,840 T73A possibly damaging Het
H2afj C G 6: 136,808,604 R89G probably damaging Het
Ifng G T 10: 118,441,249 S32I possibly damaging Het
Ildr1 A G 16: 36,709,477 probably null Het
Knl1 A C 2: 119,088,839 D1824A probably damaging Het
Lamp3 A T 16: 19,701,108 Y108* probably null Het
Lcp1 A G 14: 75,199,420 I69V probably null Het
Lrp6 A T 6: 134,457,693 V1349E probably benign Het
Lrrcc1 A T 3: 14,565,849 E1009D probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Med14 G C X: 12,685,748 R1223G probably damaging Het
Mesd C T 7: 83,897,865 Q179* probably null Het
Myh7 A G 14: 54,984,821 probably benign Het
Myo6 T C 9: 80,283,579 I804T probably damaging Het
Neb T C 2: 52,284,285 I1521V possibly damaging Het
Nosip T A 7: 45,076,916 I249N probably damaging Het
Nostrin A C 2: 69,179,416 E296A probably benign Het
Olfr1280 T A 2: 111,316,154 V225D probably damaging Het
Olfr136 A T 17: 38,335,291 I45F probably damaging Het
Olfr624 T C 7: 103,670,311 H240R probably damaging Het
Oprk1 T C 1: 5,598,850 L173S possibly damaging Het
Pdzd7 A G 19: 45,037,072 V328A probably benign Het
Podxl2 A T 6: 88,849,678 S215R probably benign Het
Prss36 T G 7: 127,935,855 T418P possibly damaging Het
Ralgps2 T A 1: 156,823,985 probably benign Het
Rasa2 T C 9: 96,545,810 probably null Het
Rgs1 A T 1: 144,245,486 I149N probably damaging Het
Rgs16 A G 1: 153,743,737 E163G probably damaging Het
Rnf121 A G 7: 102,035,346 F120S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slfn8 A T 11: 83,003,343 Y823* probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
St6gal1 T A 16: 23,356,203 probably benign Het
Tet3 G A 6: 83,369,139 P1304S probably benign Het
Timm29 T C 9: 21,593,076 probably null Het
Tpcn1 T A 5: 120,539,060 I687F probably damaging Het
Trim46 A G 3: 89,245,113 probably benign Het
Ttc23 T A 7: 67,669,852 probably benign Het
Ttll6 G T 11: 96,154,714 V586L probably benign Het
Ttn A T 2: 76,758,611 probably benign Het
Uba3 A T 6: 97,191,583 H160Q possibly damaging Het
Usp32 A G 11: 85,053,692 S316P probably damaging Het
Vcan T C 13: 89,712,191 I352M probably benign Het
Zcwpw1 G T 5: 137,817,472 L412F probably damaging Het
Zfp292 A T 4: 34,806,281 N2254K probably damaging Het
Zscan4e A G 7: 11,307,616 S138P probably damaging Het
Other mutations in Olfr491
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Olfr491 APN 7 108317518 missense probably benign 0.02
IGL01731:Olfr491 APN 7 108317475 missense probably benign 0.01
IGL02227:Olfr491 APN 7 108317201 nonsense probably null
IGL02624:Olfr491 APN 7 108316923 missense probably benign 0.38
IGL03164:Olfr491 APN 7 108317694 missense probably damaging 1.00
R0143:Olfr491 UTSW 7 108316995 missense probably benign 0.00
R0217:Olfr491 UTSW 7 108317298 missense probably benign 0.00
R2100:Olfr491 UTSW 7 108317554 missense probably benign 0.04
R2379:Olfr491 UTSW 7 108317292 missense probably benign 0.25
R4178:Olfr491 UTSW 7 108317358 missense probably damaging 1.00
R4365:Olfr491 UTSW 7 108317106 missense probably benign 0.02
R4734:Olfr491 UTSW 7 108317752 missense probably damaging 1.00
R4828:Olfr491 UTSW 7 108317470 missense probably benign 0.00
R6424:Olfr491 UTSW 7 108317205 missense probably benign 0.01
R6784:Olfr491 UTSW 7 108317782 missense probably damaging 0.98
R7109:Olfr491 UTSW 7 108317752 missense probably damaging 1.00
R7348:Olfr491 UTSW 7 108317713 missense possibly damaging 0.58
R7590:Olfr491 UTSW 7 108317179 missense probably benign 0.00
X0060:Olfr491 UTSW 7 108317220 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGAATGCATGGACATTTACTGGCTGTT -3'
(R):5'- CTGGCACACAGCAAGGGTACATTA -3'

Sequencing Primer
(F):5'- GTCTGTCCTTTTGTGGACCAAATAAG -3'
(R):5'- CACAGCAAGGGTACATTATTGTTTAG -3'
Posted On2013-05-23