Incidental Mutation 'R4876:Bbs2'
ID376876
Institutional Source Beutler Lab
Gene Symbol Bbs2
Ensembl Gene ENSMUSG00000031755
Gene NameBardet-Biedl syndrome 2 (human)
Synonyms2410125H22Rik
MMRRC Submission 042485-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R4876 (G1)
Quality Score168
Status Validated
Chromosome8
Chromosomal Location94067954-94098928 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 94070160 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034206] [ENSMUST00000060632] [ENSMUST00000093301] [ENSMUST00000109556]
Predicted Effect probably benign
Transcript: ENSMUST00000034206
SMART Domains Protein: ENSMUSP00000034206
Gene: ENSMUSG00000031755

DomainStartEndE-ValueType
Pfam:BBS2_N 20 161 1.4e-62 PFAM
Pfam:BBS2_Mid 162 272 6.9e-50 PFAM
Pfam:BBS2_C 276 715 2.6e-193 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060632
SMART Domains Protein: ENSMUSP00000051430
Gene: ENSMUSG00000033009

DomainStartEndE-ValueType
P4Hc 46 223 4.87e-26 SMART
Pfam:Ofd1_CTDD 246 513 1.4e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093301
SMART Domains Protein: ENSMUSP00000090991
Gene: ENSMUSG00000033009

DomainStartEndE-ValueType
P4Hc 61 228 2.6e-12 SMART
low complexity region 328 353 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109556
SMART Domains Protein: ENSMUSP00000105183
Gene: ENSMUSG00000033009

DomainStartEndE-ValueType
P4Hc 61 238 4.87e-26 SMART
Pfam:Ofd1_CTDD 261 528 7.2e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172347
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene forms a multiprotein BBSome complex with seven other BBS proteins.[provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous null mice display obesity associated with polyphagia, retinopathy associated with mislocalization of rhodopsin, cilia defects, renal cysts, male sterility, abnormal brain neuroanatomy, reduced salivation and acoustic startle response, an olfactory deficit and abnormal social interaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,537,577 R100H probably damaging Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
9530053A07Rik A T 7: 28,142,800 probably benign Het
A630001G21Rik C T 1: 85,719,040 V167M probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano4 A G 10: 89,112,835 F138L probably damaging Het
Aoc1 T C 6: 48,906,747 V519A possibly damaging Het
Arhgef37 A T 18: 61,498,239 Y558* probably null Het
Atxn3 T A 12: 101,948,379 S29C probably damaging Het
BC052040 A C 2: 115,670,058 H159P probably damaging Het
Bicral A T 17: 46,825,576 I236N probably damaging Het
Cabcoco1 A G 10: 68,541,769 V30A probably benign Het
Cap2 A G 13: 46,531,021 M1V probably null Het
Ccdc153 T C 9: 44,241,008 M1T probably null Het
Ccnf A T 17: 24,230,337 V489D probably damaging Het
Cntnap3 T C 13: 64,787,706 T448A probably benign Het
Cpa4 G A 6: 30,590,815 D371N probably benign Het
Csl T A 10: 99,758,540 Y221F possibly damaging Het
Dalrd3 T C 9: 108,571,436 probably benign Het
Dennd4a T A 9: 64,896,590 N1070K probably benign Het
Dmwd A T 7: 19,080,547 D374V probably damaging Het
Eea1 G T 10: 95,995,613 A189S probably benign Het
Fasn A G 11: 120,812,312 V1629A probably damaging Het
Fndc1 T C 17: 7,771,639 D1075G unknown Het
Fsip2 A G 2: 82,974,858 N507S possibly damaging Het
Gabra5 T G 7: 57,413,665 E337A probably damaging Het
Gsg1l A G 7: 125,891,669 Y288H probably benign Het
H2-M11 A T 17: 36,547,509 D65V probably benign Het
Hmgxb3 A T 18: 61,146,534 C736S possibly damaging Het
Hsd3b3 A T 3: 98,742,644 I121N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Il16 A C 7: 83,673,094 S338A probably benign Het
Itpr1 G A 6: 108,482,906 A2054T probably damaging Het
Lamp3 T A 16: 19,655,470 I385F probably damaging Het
Limch1 G A 5: 66,881,927 V66I possibly damaging Het
Lmod2 A G 6: 24,604,279 R418G probably benign Het
Ly6g6c A T 17: 35,069,440 D96V probably damaging Het
Map2k2 G A 10: 81,115,113 V131M probably damaging Het
Mapk9 T C 11: 49,854,325 V22A probably damaging Het
Mettl2 T C 11: 105,129,068 I177T probably damaging Het
Mob4 C T 1: 55,152,836 probably benign Het
Mybpc1 T C 10: 88,522,991 I1113V probably benign Het
Mybpc1 A T 10: 88,536,424 N781K probably benign Het
Myom1 A G 17: 71,077,410 T707A probably damaging Het
Ncam2 G A 16: 81,490,346 A383T probably benign Het
Nomo1 T C 7: 46,066,491 S761P probably damaging Het
Nsd3 T A 8: 25,691,134 S921T possibly damaging Het
Olfr268-ps1 C G 2: 111,844,695 noncoding transcript Het
Olfr934 A T 9: 38,982,626 C139* probably null Het
Olfr985 C T 9: 40,127,218 V248I probably damaging Het
Omp A T 7: 98,145,026 D131E probably benign Het
Pard3 T C 8: 127,561,469 probably benign Het
Parg A G 14: 32,271,668 T286A probably damaging Het
Parp1 T A 1: 180,569,035 M1K probably null Het
Pclo T A 5: 14,811,680 S4882R unknown Het
Pcnx2 C T 8: 125,772,108 E1551K probably damaging Het
Pcyox1l A G 18: 61,699,494 Y161H probably damaging Het
Pdzd8 A T 19: 59,300,804 C721* probably null Het
Piwil4 T C 9: 14,740,465 D90G probably benign Het
Plxdc2 T A 2: 16,703,318 C306S probably damaging Het
Plxna2 T A 1: 194,643,775 F6I probably benign Het
Prkaa1 T C 15: 5,174,405 M265T probably benign Het
Prrc2b T C 2: 32,214,200 V1230A probably benign Het
Rfx2 T C 17: 56,784,706 E329G probably benign Het
Scg2 T C 1: 79,435,919 I322M probably damaging Het
Scly T A 1: 91,320,128 N399K probably damaging Het
Sec23b T A 2: 144,586,361 probably null Het
Sephs2 A T 7: 127,273,047 Y291* probably null Het
Slc45a3 T C 1: 131,981,547 I494T possibly damaging Het
Slc6a21 C A 7: 45,280,111 Y76* probably null Het
Slfn14 T A 11: 83,276,272 I806L possibly damaging Het
Slfn4 T A 11: 83,187,018 S211T probably benign Het
Sptbn4 A G 7: 27,372,152 V1624A probably damaging Het
Sugp1 T A 8: 70,071,184 M567K probably damaging Het
Tmem121 A T 12: 113,188,728 M189L probably benign Het
Tmem201 A G 4: 149,722,270 S444P probably damaging Het
Tmem63a T C 1: 180,973,186 V744A probably benign Het
Tnrc18 G A 5: 142,731,625 S2358F unknown Het
Ubash3b A G 9: 41,018,109 V404A probably benign Het
Unc13c A T 9: 73,749,539 C1127S probably damaging Het
Unc5a T C 13: 54,997,229 V253A probably benign Het
Vmn1r-ps123 C T 13: 22,996,365 noncoding transcript Het
Wdr74 A G 19: 8,739,485 E253G possibly damaging Het
Wwox T C 8: 114,448,248 Y107H probably damaging Het
Zdhhc22 A T 12: 86,988,238 Y147N probably damaging Het
Zfp131 T C 13: 119,788,955 H44R possibly damaging Het
Zfp235 A G 7: 24,140,959 T268A probably benign Het
Zfp280d T C 9: 72,298,858 probably benign Het
Zfp358 T C 8: 3,496,170 S251P probably damaging Het
Other mutations in Bbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Bbs2 APN 8 94089167 critical splice acceptor site probably null
IGL02250:Bbs2 APN 8 94092426 missense probably benign 0.22
IGL02427:Bbs2 APN 8 94081118 missense possibly damaging 0.92
IGL02810:Bbs2 APN 8 94086911 missense probably benign 0.00
IGL02850:Bbs2 APN 8 94077082 missense probably benign
IGL03050:Bbs2 APN 8 94074413 splice site probably benign
IGL03292:Bbs2 APN 8 94075121 critical splice donor site probably null
R0755:Bbs2 UTSW 8 94082080 missense probably benign 0.22
R0835:Bbs2 UTSW 8 94075259 missense probably damaging 1.00
R1404:Bbs2 UTSW 8 94081999 missense probably null 0.01
R1404:Bbs2 UTSW 8 94081999 missense probably null 0.01
R1513:Bbs2 UTSW 8 94089844 missense possibly damaging 0.94
R1972:Bbs2 UTSW 8 94081177 splice site probably benign
R4648:Bbs2 UTSW 8 94080879 missense probably damaging 1.00
R4911:Bbs2 UTSW 8 94089115 missense probably damaging 1.00
R4966:Bbs2 UTSW 8 94080807 missense probably damaging 1.00
R4982:Bbs2 UTSW 8 94082354 critical splice donor site probably null
R5202:Bbs2 UTSW 8 94092414 nonsense probably null
R5347:Bbs2 UTSW 8 94092550 missense probably damaging 0.98
R5364:Bbs2 UTSW 8 94074395 missense probably benign 0.00
R5538:Bbs2 UTSW 8 94089763 missense probably damaging 1.00
R5685:Bbs2 UTSW 8 94087433 missense probably damaging 1.00
R5918:Bbs2 UTSW 8 94098303 missense probably damaging 0.98
R5963:Bbs2 UTSW 8 94081031 missense probably benign 0.02
R5964:Bbs2 UTSW 8 94068367 missense probably benign 0.18
R5991:Bbs2 UTSW 8 94098286 missense probably benign 0.24
R6050:Bbs2 UTSW 8 94092532 missense probably damaging 1.00
R6172:Bbs2 UTSW 8 94087411 missense probably benign 0.02
R6241:Bbs2 UTSW 8 94098235 critical splice donor site probably null
R6578:Bbs2 UTSW 8 94077041 missense probably null 0.00
R7330:Bbs2 UTSW 8 94087405 missense possibly damaging 0.78
R7404:Bbs2 UTSW 8 94082364 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGATTGCTTGGTTCACCGC -3'
(R):5'- ACAGACCAGTTCAGAGCTTAAG -3'

Sequencing Primer
(F):5'- GCCTTCAGGTTTCCTAGCAG -3'
(R):5'- TAAAAATGTGCCTGCCTGCC -3'
Posted On2016-03-17