Incidental Mutation 'R4876:Zfp280d'
ID 376887
Institutional Source Beutler Lab
Gene Symbol Zfp280d
Ensembl Gene ENSMUSG00000038535
Gene Name zinc finger protein 280D
Synonyms Suhw4
MMRRC Submission 042485-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R4876 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 72182142-72271059 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 72206140 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000098576] [ENSMUST00000183410] [ENSMUST00000183801] [ENSMUST00000184036] [ENSMUST00000184053] [ENSMUST00000184517] [ENSMUST00000184399]
AlphaFold Q68FE8
Predicted Effect probably benign
Transcript: ENSMUST00000098576
SMART Domains Protein: ENSMUSP00000096175
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 241 6.8e-82 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183400
Predicted Effect probably benign
Transcript: ENSMUST00000183410
SMART Domains Protein: ENSMUSP00000139250
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 4.1e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183801
SMART Domains Protein: ENSMUSP00000139091
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 1.9e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184036
SMART Domains Protein: ENSMUSP00000138857
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:DUF4195 32 217 5.5e-98 PFAM
ZnF_C2H2 227 247 1.24e2 SMART
ZnF_C2H2 308 330 6.92e0 SMART
ZnF_C2H2 345 368 3.99e0 SMART
ZnF_C2H2 375 398 1.08e-1 SMART
ZnF_C2H2 405 428 3.52e-1 SMART
ZnF_C2H2 434 456 2.41e1 SMART
ZnF_C2H2 462 484 3.38e1 SMART
low complexity region 514 536 N/A INTRINSIC
low complexity region 566 586 N/A INTRINSIC
ZnF_C2H2 631 654 1.23e1 SMART
ZnF_C2H2 677 701 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184053
SMART Domains Protein: ENSMUSP00000138848
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 147 1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184517
SMART Domains Protein: ENSMUSP00000138970
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 2.2e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184786
Predicted Effect probably benign
Transcript: ENSMUST00000184399
SMART Domains Protein: ENSMUSP00000138902
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 103 4.8e-23 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 99% (97/98)
Allele List at MGI

All alleles(100) : Targeted(2) Gene trapped(98)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,536 (GRCm39) F309S unknown Het
A630001G21Rik C T 1: 85,646,761 (GRCm39) V167M probably damaging Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Ano4 A G 10: 88,948,697 (GRCm39) F138L probably damaging Het
Aoc1 T C 6: 48,883,681 (GRCm39) V519A possibly damaging Het
Arhgef37 A T 18: 61,631,310 (GRCm39) Y558* probably null Het
Atxn3 T A 12: 101,914,638 (GRCm39) S29C probably damaging Het
Bbs2 T C 8: 94,796,788 (GRCm39) probably benign Het
Bicral A T 17: 47,136,502 (GRCm39) I236N probably damaging Het
Cabcoco1 A G 10: 68,377,599 (GRCm39) V30A probably benign Het
Cap2 A G 13: 46,684,497 (GRCm39) M1V probably null Het
Ccdc153 T C 9: 44,152,305 (GRCm39) M1T probably null Het
Ccnf A T 17: 24,449,311 (GRCm39) V489D probably damaging Het
Cdin1 A C 2: 115,500,539 (GRCm39) H159P probably damaging Het
Cntnap3 T C 13: 64,935,520 (GRCm39) T448A probably benign Het
Cpa4 G A 6: 30,590,814 (GRCm39) D371N probably benign Het
Csl T A 10: 99,594,402 (GRCm39) Y221F possibly damaging Het
Dalrd3 T C 9: 108,448,635 (GRCm39) probably benign Het
Dennd4a T A 9: 64,803,872 (GRCm39) N1070K probably benign Het
Dipk2a C T 9: 94,419,630 (GRCm39) R100H probably damaging Het
Dmwd A T 7: 18,814,472 (GRCm39) D374V probably damaging Het
Eea1 G T 10: 95,831,475 (GRCm39) A189S probably benign Het
Fasn A G 11: 120,703,138 (GRCm39) V1629A probably damaging Het
Fcgbpl1 A T 7: 27,842,225 (GRCm39) probably benign Het
Fndc1 T C 17: 7,990,471 (GRCm39) D1075G unknown Het
Fsip2 A G 2: 82,805,202 (GRCm39) N507S possibly damaging Het
Gabra5 T G 7: 57,063,413 (GRCm39) E337A probably damaging Het
Gsg1l A G 7: 125,490,841 (GRCm39) Y288H probably benign Het
H2-M11 A T 17: 36,858,401 (GRCm39) D65V probably benign Het
Hmgxb3 A T 18: 61,279,606 (GRCm39) C736S possibly damaging Het
Hsd3b3 A T 3: 98,649,960 (GRCm39) I121N probably damaging Het
Ikbke GCC G 1: 131,203,004 (GRCm39) probably null Het
Il16 A C 7: 83,322,302 (GRCm39) S338A probably benign Het
Itpr1 G A 6: 108,459,867 (GRCm39) A2054T probably damaging Het
Lamp3 T A 16: 19,474,220 (GRCm39) I385F probably damaging Het
Limch1 G A 5: 67,039,270 (GRCm39) V66I possibly damaging Het
Lmod2 A G 6: 24,604,278 (GRCm39) R418G probably benign Het
Ly6g6c A T 17: 35,288,416 (GRCm39) D96V probably damaging Het
Map2k2 G A 10: 80,950,947 (GRCm39) V131M probably damaging Het
Mapk9 T C 11: 49,745,152 (GRCm39) V22A probably damaging Het
Mettl2 T C 11: 105,019,894 (GRCm39) I177T probably damaging Het
Mob4 C T 1: 55,191,995 (GRCm39) probably benign Het
Mybpc1 A T 10: 88,372,286 (GRCm39) N781K probably benign Het
Mybpc1 T C 10: 88,358,853 (GRCm39) I1113V probably benign Het
Myom1 A G 17: 71,384,405 (GRCm39) T707A probably damaging Het
Ncam2 G A 16: 81,287,234 (GRCm39) A383T probably benign Het
Nomo1 T C 7: 45,715,915 (GRCm39) S761P probably damaging Het
Nsd3 T A 8: 26,181,161 (GRCm39) S921T possibly damaging Het
Omp A T 7: 97,794,233 (GRCm39) D131E probably benign Het
Or10d1c A T 9: 38,893,922 (GRCm39) C139* probably null Het
Or4f7d-ps1 C G 2: 111,675,040 (GRCm39) noncoding transcript Het
Or8d4 C T 9: 40,038,514 (GRCm39) V248I probably damaging Het
Pard3 T C 8: 128,287,950 (GRCm39) probably benign Het
Parg A G 14: 31,993,625 (GRCm39) T286A probably damaging Het
Parp1 T A 1: 180,396,600 (GRCm39) M1K probably null Het
Pclo T A 5: 14,861,694 (GRCm39) S4882R unknown Het
Pcnx2 C T 8: 126,498,847 (GRCm39) E1551K probably damaging Het
Pcyox1l A G 18: 61,832,565 (GRCm39) Y161H probably damaging Het
Pdzd8 A T 19: 59,289,236 (GRCm39) C721* probably null Het
Piwil4 T C 9: 14,651,761 (GRCm39) D90G probably benign Het
Plxdc2 T A 2: 16,708,129 (GRCm39) C306S probably damaging Het
Plxna2 T A 1: 194,326,083 (GRCm39) F6I probably benign Het
Prkaa1 T C 15: 5,203,886 (GRCm39) M265T probably benign Het
Prrc2b T C 2: 32,104,212 (GRCm39) V1230A probably benign Het
Rfx2 T C 17: 57,091,706 (GRCm39) E329G probably benign Het
Scg2 T C 1: 79,413,636 (GRCm39) I322M probably damaging Het
Scly T A 1: 91,247,850 (GRCm39) N399K probably damaging Het
Sec23b T A 2: 144,428,281 (GRCm39) probably null Het
Sephs2 A T 7: 126,872,219 (GRCm39) Y291* probably null Het
Slc45a3 T C 1: 131,909,285 (GRCm39) I494T possibly damaging Het
Slc6a21 C A 7: 44,929,535 (GRCm39) Y76* probably null Het
Slfn14 T A 11: 83,167,098 (GRCm39) I806L possibly damaging Het
Slfn4 T A 11: 83,077,844 (GRCm39) S211T probably benign Het
Sptbn4 A G 7: 27,071,577 (GRCm39) V1624A probably damaging Het
Sugp1 T A 8: 70,523,834 (GRCm39) M567K probably damaging Het
Tmem121 A T 12: 113,152,348 (GRCm39) M189L probably benign Het
Tmem201 A G 4: 149,806,727 (GRCm39) S444P probably damaging Het
Tmem63a T C 1: 180,800,751 (GRCm39) V744A probably benign Het
Tnrc18 G A 5: 142,717,380 (GRCm39) S2358F unknown Het
Ubash3b A G 9: 40,929,405 (GRCm39) V404A probably benign Het
Unc13c A T 9: 73,656,821 (GRCm39) C1127S probably damaging Het
Unc5a T C 13: 55,145,042 (GRCm39) V253A probably benign Het
Vmn1r-ps123 C T 13: 23,180,535 (GRCm39) noncoding transcript Het
Wdr74 A G 19: 8,716,849 (GRCm39) E253G possibly damaging Het
Wwox T C 8: 115,174,988 (GRCm39) Y107H probably damaging Het
Zdhhc22 A T 12: 87,035,012 (GRCm39) Y147N probably damaging Het
Zfp131 T C 13: 120,250,491 (GRCm39) H44R possibly damaging Het
Zfp235 A G 7: 23,840,384 (GRCm39) T268A probably benign Het
Zfp358 T C 8: 3,546,170 (GRCm39) S251P probably damaging Het
Other mutations in Zfp280d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Zfp280d APN 9 72,229,853 (GRCm39) missense probably damaging 1.00
IGL00708:Zfp280d APN 9 72,219,417 (GRCm39) missense probably benign 0.19
IGL01333:Zfp280d APN 9 72,242,396 (GRCm39) splice site probably benign
IGL01453:Zfp280d APN 9 72,229,868 (GRCm39) missense possibly damaging 0.90
IGL02472:Zfp280d APN 9 72,208,993 (GRCm39) missense probably damaging 1.00
IGL02583:Zfp280d APN 9 72,229,727 (GRCm39) splice site probably benign
IGL02608:Zfp280d APN 9 72,215,261 (GRCm39) missense probably damaging 0.98
IGL02675:Zfp280d APN 9 72,219,504 (GRCm39) missense probably benign 0.33
IGL02676:Zfp280d APN 9 72,242,356 (GRCm39) missense probably damaging 1.00
IGL02931:Zfp280d APN 9 72,203,307 (GRCm39) missense probably benign 0.02
IGL03076:Zfp280d APN 9 72,219,944 (GRCm39) missense probably damaging 0.99
R0017:Zfp280d UTSW 9 72,246,292 (GRCm39) critical splice acceptor site probably null
R0017:Zfp280d UTSW 9 72,246,292 (GRCm39) critical splice acceptor site probably null
R0288:Zfp280d UTSW 9 72,238,621 (GRCm39) nonsense probably null
R0419:Zfp280d UTSW 9 72,219,519 (GRCm39) missense probably benign 0.02
R0540:Zfp280d UTSW 9 72,215,247 (GRCm39) missense probably damaging 0.97
R0628:Zfp280d UTSW 9 72,269,230 (GRCm39) missense probably benign
R0722:Zfp280d UTSW 9 72,219,383 (GRCm39) missense possibly damaging 0.63
R1055:Zfp280d UTSW 9 72,236,449 (GRCm39) splice site probably null
R1786:Zfp280d UTSW 9 72,215,287 (GRCm39) missense probably damaging 1.00
R1826:Zfp280d UTSW 9 72,206,062 (GRCm39) missense probably damaging 1.00
R1962:Zfp280d UTSW 9 72,242,362 (GRCm39) nonsense probably null
R2130:Zfp280d UTSW 9 72,215,287 (GRCm39) missense probably damaging 1.00
R2132:Zfp280d UTSW 9 72,215,287 (GRCm39) missense probably damaging 1.00
R2133:Zfp280d UTSW 9 72,215,287 (GRCm39) missense probably damaging 1.00
R2143:Zfp280d UTSW 9 72,220,011 (GRCm39) missense probably damaging 1.00
R2162:Zfp280d UTSW 9 72,206,104 (GRCm39) missense probably damaging 1.00
R2266:Zfp280d UTSW 9 72,209,052 (GRCm39) splice site probably benign
R2269:Zfp280d UTSW 9 72,209,052 (GRCm39) splice site probably benign
R2278:Zfp280d UTSW 9 72,246,055 (GRCm39) nonsense probably null
R2850:Zfp280d UTSW 9 72,219,371 (GRCm39) missense probably benign 0.06
R3780:Zfp280d UTSW 9 72,229,806 (GRCm39) missense probably damaging 1.00
R3950:Zfp280d UTSW 9 72,203,301 (GRCm39) missense possibly damaging 0.49
R4330:Zfp280d UTSW 9 72,203,261 (GRCm39) missense possibly damaging 0.86
R4716:Zfp280d UTSW 9 72,219,947 (GRCm39) missense possibly damaging 0.94
R4909:Zfp280d UTSW 9 72,238,714 (GRCm39) missense probably damaging 1.00
R5214:Zfp280d UTSW 9 72,215,395 (GRCm39) unclassified probably benign
R5518:Zfp280d UTSW 9 72,231,417 (GRCm39) missense probably damaging 0.99
R5853:Zfp280d UTSW 9 72,238,224 (GRCm39) missense probably benign 0.20
R5945:Zfp280d UTSW 9 72,269,614 (GRCm39) nonsense probably null
R6033:Zfp280d UTSW 9 72,236,419 (GRCm39) missense probably damaging 1.00
R6033:Zfp280d UTSW 9 72,236,419 (GRCm39) missense probably damaging 1.00
R7043:Zfp280d UTSW 9 72,226,539 (GRCm39) missense probably damaging 1.00
R7501:Zfp280d UTSW 9 72,269,224 (GRCm39) missense possibly damaging 0.65
R7658:Zfp280d UTSW 9 72,231,354 (GRCm39) missense probably damaging 1.00
R7667:Zfp280d UTSW 9 72,209,247 (GRCm39) missense probably damaging 1.00
R7792:Zfp280d UTSW 9 72,238,601 (GRCm39) missense probably damaging 1.00
R7826:Zfp280d UTSW 9 72,219,953 (GRCm39) missense possibly damaging 0.68
R7964:Zfp280d UTSW 9 72,229,740 (GRCm39) missense probably damaging 1.00
R8096:Zfp280d UTSW 9 72,226,560 (GRCm39) missense probably damaging 1.00
R8188:Zfp280d UTSW 9 72,267,615 (GRCm39) missense probably benign 0.01
R9210:Zfp280d UTSW 9 72,269,789 (GRCm39) makesense probably null
R9212:Zfp280d UTSW 9 72,269,789 (GRCm39) makesense probably null
R9435:Zfp280d UTSW 9 72,226,599 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACGTAGCAGGATCTCAGTTTC -3'
(R):5'- AAATTCCCTGTTGCGTCTGC -3'

Sequencing Primer
(F):5'- CGTAGCAGGATCTCAGTTTCTTATTG -3'
(R):5'- GCGTCTGCTGGTATTTTGCTTCTATC -3'
Posted On 2016-03-17