Incidental Mutation 'R4876:Unc13c'
ID 376888
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Name unc-13 homolog C
Synonyms D9Ertd414e, 1500037O19Rik, Munc13-3, Unc13h3
MMRRC Submission 042485-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4876 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 73386704-73876248 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73656821 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1127 (C1127S)
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
AlphaFold Q8K0T7
Predicted Effect probably damaging
Transcript: ENSMUST00000075245
AA Change: C1127S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: C1127S

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184666
AA Change: C1127S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: C1127S

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Meta Mutation Damage Score 0.9440 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 99% (97/98)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,536 (GRCm39) F309S unknown Het
A630001G21Rik C T 1: 85,646,761 (GRCm39) V167M probably damaging Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Ano4 A G 10: 88,948,697 (GRCm39) F138L probably damaging Het
Aoc1 T C 6: 48,883,681 (GRCm39) V519A possibly damaging Het
Arhgef37 A T 18: 61,631,310 (GRCm39) Y558* probably null Het
Atxn3 T A 12: 101,914,638 (GRCm39) S29C probably damaging Het
Bbs2 T C 8: 94,796,788 (GRCm39) probably benign Het
Bicral A T 17: 47,136,502 (GRCm39) I236N probably damaging Het
Cabcoco1 A G 10: 68,377,599 (GRCm39) V30A probably benign Het
Cap2 A G 13: 46,684,497 (GRCm39) M1V probably null Het
Ccdc153 T C 9: 44,152,305 (GRCm39) M1T probably null Het
Ccnf A T 17: 24,449,311 (GRCm39) V489D probably damaging Het
Cdin1 A C 2: 115,500,539 (GRCm39) H159P probably damaging Het
Cntnap3 T C 13: 64,935,520 (GRCm39) T448A probably benign Het
Cpa4 G A 6: 30,590,814 (GRCm39) D371N probably benign Het
Csl T A 10: 99,594,402 (GRCm39) Y221F possibly damaging Het
Dalrd3 T C 9: 108,448,635 (GRCm39) probably benign Het
Dennd4a T A 9: 64,803,872 (GRCm39) N1070K probably benign Het
Dipk2a C T 9: 94,419,630 (GRCm39) R100H probably damaging Het
Dmwd A T 7: 18,814,472 (GRCm39) D374V probably damaging Het
Eea1 G T 10: 95,831,475 (GRCm39) A189S probably benign Het
Fasn A G 11: 120,703,138 (GRCm39) V1629A probably damaging Het
Fcgbpl1 A T 7: 27,842,225 (GRCm39) probably benign Het
Fndc1 T C 17: 7,990,471 (GRCm39) D1075G unknown Het
Fsip2 A G 2: 82,805,202 (GRCm39) N507S possibly damaging Het
Gabra5 T G 7: 57,063,413 (GRCm39) E337A probably damaging Het
Gsg1l A G 7: 125,490,841 (GRCm39) Y288H probably benign Het
H2-M11 A T 17: 36,858,401 (GRCm39) D65V probably benign Het
Hmgxb3 A T 18: 61,279,606 (GRCm39) C736S possibly damaging Het
Hsd3b3 A T 3: 98,649,960 (GRCm39) I121N probably damaging Het
Ikbke GCC G 1: 131,203,004 (GRCm39) probably null Het
Il16 A C 7: 83,322,302 (GRCm39) S338A probably benign Het
Itpr1 G A 6: 108,459,867 (GRCm39) A2054T probably damaging Het
Lamp3 T A 16: 19,474,220 (GRCm39) I385F probably damaging Het
Limch1 G A 5: 67,039,270 (GRCm39) V66I possibly damaging Het
Lmod2 A G 6: 24,604,278 (GRCm39) R418G probably benign Het
Ly6g6c A T 17: 35,288,416 (GRCm39) D96V probably damaging Het
Map2k2 G A 10: 80,950,947 (GRCm39) V131M probably damaging Het
Mapk9 T C 11: 49,745,152 (GRCm39) V22A probably damaging Het
Mettl2 T C 11: 105,019,894 (GRCm39) I177T probably damaging Het
Mob4 C T 1: 55,191,995 (GRCm39) probably benign Het
Mybpc1 A T 10: 88,372,286 (GRCm39) N781K probably benign Het
Mybpc1 T C 10: 88,358,853 (GRCm39) I1113V probably benign Het
Myom1 A G 17: 71,384,405 (GRCm39) T707A probably damaging Het
Ncam2 G A 16: 81,287,234 (GRCm39) A383T probably benign Het
Nomo1 T C 7: 45,715,915 (GRCm39) S761P probably damaging Het
Nsd3 T A 8: 26,181,161 (GRCm39) S921T possibly damaging Het
Omp A T 7: 97,794,233 (GRCm39) D131E probably benign Het
Or10d1c A T 9: 38,893,922 (GRCm39) C139* probably null Het
Or4f7d-ps1 C G 2: 111,675,040 (GRCm39) noncoding transcript Het
Or8d4 C T 9: 40,038,514 (GRCm39) V248I probably damaging Het
Pard3 T C 8: 128,287,950 (GRCm39) probably benign Het
Parg A G 14: 31,993,625 (GRCm39) T286A probably damaging Het
Parp1 T A 1: 180,396,600 (GRCm39) M1K probably null Het
Pclo T A 5: 14,861,694 (GRCm39) S4882R unknown Het
Pcnx2 C T 8: 126,498,847 (GRCm39) E1551K probably damaging Het
Pcyox1l A G 18: 61,832,565 (GRCm39) Y161H probably damaging Het
Pdzd8 A T 19: 59,289,236 (GRCm39) C721* probably null Het
Piwil4 T C 9: 14,651,761 (GRCm39) D90G probably benign Het
Plxdc2 T A 2: 16,708,129 (GRCm39) C306S probably damaging Het
Plxna2 T A 1: 194,326,083 (GRCm39) F6I probably benign Het
Prkaa1 T C 15: 5,203,886 (GRCm39) M265T probably benign Het
Prrc2b T C 2: 32,104,212 (GRCm39) V1230A probably benign Het
Rfx2 T C 17: 57,091,706 (GRCm39) E329G probably benign Het
Scg2 T C 1: 79,413,636 (GRCm39) I322M probably damaging Het
Scly T A 1: 91,247,850 (GRCm39) N399K probably damaging Het
Sec23b T A 2: 144,428,281 (GRCm39) probably null Het
Sephs2 A T 7: 126,872,219 (GRCm39) Y291* probably null Het
Slc45a3 T C 1: 131,909,285 (GRCm39) I494T possibly damaging Het
Slc6a21 C A 7: 44,929,535 (GRCm39) Y76* probably null Het
Slfn14 T A 11: 83,167,098 (GRCm39) I806L possibly damaging Het
Slfn4 T A 11: 83,077,844 (GRCm39) S211T probably benign Het
Sptbn4 A G 7: 27,071,577 (GRCm39) V1624A probably damaging Het
Sugp1 T A 8: 70,523,834 (GRCm39) M567K probably damaging Het
Tmem121 A T 12: 113,152,348 (GRCm39) M189L probably benign Het
Tmem201 A G 4: 149,806,727 (GRCm39) S444P probably damaging Het
Tmem63a T C 1: 180,800,751 (GRCm39) V744A probably benign Het
Tnrc18 G A 5: 142,717,380 (GRCm39) S2358F unknown Het
Ubash3b A G 9: 40,929,405 (GRCm39) V404A probably benign Het
Unc5a T C 13: 55,145,042 (GRCm39) V253A probably benign Het
Vmn1r-ps123 C T 13: 23,180,535 (GRCm39) noncoding transcript Het
Wdr74 A G 19: 8,716,849 (GRCm39) E253G possibly damaging Het
Wwox T C 8: 115,174,988 (GRCm39) Y107H probably damaging Het
Zdhhc22 A T 12: 87,035,012 (GRCm39) Y147N probably damaging Het
Zfp131 T C 13: 120,250,491 (GRCm39) H44R possibly damaging Het
Zfp235 A G 7: 23,840,384 (GRCm39) T268A probably benign Het
Zfp280d T C 9: 72,206,140 (GRCm39) probably benign Het
Zfp358 T C 8: 3,546,170 (GRCm39) S251P probably damaging Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73,643,985 (GRCm39) missense probably damaging 0.99
IGL00693:Unc13c APN 9 73,665,884 (GRCm39) missense probably benign 0.18
IGL01022:Unc13c APN 9 73,424,610 (GRCm39) missense probably benign 0.06
IGL01088:Unc13c APN 9 73,839,563 (GRCm39) missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73,840,479 (GRCm39) missense probably benign 0.05
IGL01131:Unc13c APN 9 73,471,335 (GRCm39) missense probably benign
IGL01135:Unc13c APN 9 73,392,175 (GRCm39) missense probably damaging 1.00
IGL01393:Unc13c APN 9 73,447,552 (GRCm39) missense probably benign 0.06
IGL01752:Unc13c APN 9 73,839,093 (GRCm39) missense probably benign 0.01
IGL01893:Unc13c APN 9 73,600,648 (GRCm39) missense probably benign 0.15
IGL01897:Unc13c APN 9 73,453,309 (GRCm39) missense probably damaging 0.99
IGL01936:Unc13c APN 9 73,600,524 (GRCm39) missense probably benign 0.07
IGL02122:Unc13c APN 9 73,641,679 (GRCm39) splice site probably benign
IGL02341:Unc13c APN 9 73,840,492 (GRCm39) missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73,839,910 (GRCm39) missense probably benign 0.01
IGL02545:Unc13c APN 9 73,388,357 (GRCm39) missense probably damaging 0.98
IGL02709:Unc13c APN 9 73,466,238 (GRCm39) missense probably benign 0.00
IGL02815:Unc13c APN 9 73,447,545 (GRCm39) missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73,388,349 (GRCm39) nonsense probably null
IGL03117:Unc13c APN 9 73,441,307 (GRCm39) missense probably benign 0.03
IGL03260:Unc13c APN 9 73,838,626 (GRCm39) missense probably benign 0.11
Feeling UTSW 9 73,600,553 (GRCm39) missense possibly damaging 0.46
Inkling UTSW 9 73,839,126 (GRCm39) missense probably damaging 1.00
notion UTSW 9 73,643,844 (GRCm39) missense probably damaging 1.00
BB001:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
BB011:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
PIT4431001:Unc13c UTSW 9 73,656,829 (GRCm39) missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73,391,021 (GRCm39) missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73,600,583 (GRCm39) missense probably benign 0.07
R0039:Unc13c UTSW 9 73,576,847 (GRCm39) splice site probably benign
R0164:Unc13c UTSW 9 73,602,174 (GRCm39) missense probably benign 0.01
R0164:Unc13c UTSW 9 73,602,174 (GRCm39) missense probably benign 0.01
R0308:Unc13c UTSW 9 73,388,400 (GRCm39) missense probably benign 0.04
R0344:Unc13c UTSW 9 73,838,067 (GRCm39) missense probably benign 0.39
R0421:Unc13c UTSW 9 73,840,492 (GRCm39) missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73,438,265 (GRCm39) splice site probably benign
R0655:Unc13c UTSW 9 73,838,235 (GRCm39) missense probably damaging 0.96
R1013:Unc13c UTSW 9 73,840,614 (GRCm39) missense probably benign 0.45
R1293:Unc13c UTSW 9 73,481,356 (GRCm39) missense probably benign 0.06
R1493:Unc13c UTSW 9 73,546,350 (GRCm39) missense probably benign 0.27
R1675:Unc13c UTSW 9 73,546,332 (GRCm39) critical splice donor site probably null
R1789:Unc13c UTSW 9 73,663,621 (GRCm39) missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73,390,897 (GRCm39) splice site probably null
R2055:Unc13c UTSW 9 73,643,832 (GRCm39) missense probably damaging 1.00
R2060:Unc13c UTSW 9 73,572,938 (GRCm39) missense probably damaging 0.99
R2420:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R2421:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R2422:Unc13c UTSW 9 73,838,829 (GRCm39) missense probably damaging 0.97
R3415:Unc13c UTSW 9 73,839,868 (GRCm39) missense probably benign 0.00
R3423:Unc13c UTSW 9 73,837,935 (GRCm39) missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73,838,240 (GRCm39) missense probably benign 0.00
R3857:Unc13c UTSW 9 73,606,390 (GRCm39) nonsense probably null
R3859:Unc13c UTSW 9 73,606,390 (GRCm39) nonsense probably null
R3895:Unc13c UTSW 9 73,840,805 (GRCm39) missense probably benign
R4038:Unc13c UTSW 9 73,441,188 (GRCm39) critical splice donor site probably null
R4077:Unc13c UTSW 9 73,643,821 (GRCm39) nonsense probably null
R4125:Unc13c UTSW 9 73,481,289 (GRCm39) critical splice donor site probably null
R4128:Unc13c UTSW 9 73,641,819 (GRCm39) missense probably damaging 1.00
R4235:Unc13c UTSW 9 73,438,234 (GRCm39) missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73,641,786 (GRCm39) missense probably damaging 1.00
R4307:Unc13c UTSW 9 73,600,649 (GRCm39) missense probably benign 0.06
R4658:Unc13c UTSW 9 73,840,108 (GRCm39) missense probably damaging 1.00
R4694:Unc13c UTSW 9 73,479,636 (GRCm39) missense probably benign 0.00
R4735:Unc13c UTSW 9 73,600,620 (GRCm39) missense probably benign 0.00
R4744:Unc13c UTSW 9 73,839,126 (GRCm39) missense probably damaging 1.00
R4795:Unc13c UTSW 9 73,839,469 (GRCm39) missense probably damaging 0.97
R4827:Unc13c UTSW 9 73,838,568 (GRCm39) missense probably damaging 1.00
R4838:Unc13c UTSW 9 73,839,354 (GRCm39) missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73,587,716 (GRCm39) missense probably benign 0.02
R4873:Unc13c UTSW 9 73,424,566 (GRCm39) missense probably damaging 0.98
R4875:Unc13c UTSW 9 73,424,566 (GRCm39) missense probably damaging 0.98
R4905:Unc13c UTSW 9 73,587,674 (GRCm39) missense probably benign
R4912:Unc13c UTSW 9 73,481,304 (GRCm39) missense probably damaging 0.99
R5026:Unc13c UTSW 9 73,838,185 (GRCm39) missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73,840,654 (GRCm39) missense probably benign 0.26
R5151:Unc13c UTSW 9 73,838,757 (GRCm39) missense probably benign 0.02
R5171:Unc13c UTSW 9 73,665,236 (GRCm39) missense probably benign
R5244:Unc13c UTSW 9 73,433,233 (GRCm39) critical splice donor site probably null
R5342:Unc13c UTSW 9 73,838,105 (GRCm39) missense probably benign 0.00
R5399:Unc13c UTSW 9 73,656,970 (GRCm39) missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73,485,672 (GRCm39) missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73,453,271 (GRCm39) missense probably benign
R5680:Unc13c UTSW 9 73,839,884 (GRCm39) missense probably damaging 1.00
R5681:Unc13c UTSW 9 73,453,357 (GRCm39) splice site probably null
R5728:Unc13c UTSW 9 73,466,238 (GRCm39) missense probably benign 0.01
R5762:Unc13c UTSW 9 73,719,649 (GRCm39) missense probably benign 0.00
R5764:Unc13c UTSW 9 73,441,185 (GRCm39) splice site probably null
R5829:Unc13c UTSW 9 73,600,650 (GRCm39) missense probably benign 0.15
R5894:Unc13c UTSW 9 73,600,486 (GRCm39) critical splice donor site probably null
R5936:Unc13c UTSW 9 73,485,774 (GRCm39) missense probably damaging 1.00
R6043:Unc13c UTSW 9 73,643,933 (GRCm39) missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73,838,166 (GRCm39) missense probably benign
R6148:Unc13c UTSW 9 73,600,648 (GRCm39) missense probably benign 0.15
R6207:Unc13c UTSW 9 73,665,910 (GRCm39) missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73,606,451 (GRCm39) missense probably damaging 1.00
R6338:Unc13c UTSW 9 73,641,729 (GRCm39) missense probably damaging 0.99
R6615:Unc13c UTSW 9 73,837,890 (GRCm39) missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73,839,259 (GRCm39) missense probably benign 0.39
R7053:Unc13c UTSW 9 73,839,579 (GRCm39) missense probably damaging 1.00
R7223:Unc13c UTSW 9 73,536,473 (GRCm39) missense probably benign 0.44
R7259:Unc13c UTSW 9 73,424,645 (GRCm39) missense probably benign 0.00
R7353:Unc13c UTSW 9 73,481,355 (GRCm39) missense probably benign 0.00
R7357:Unc13c UTSW 9 73,840,811 (GRCm39) small insertion probably benign
R7357:Unc13c UTSW 9 73,840,810 (GRCm39) small insertion probably benign
R7607:Unc13c UTSW 9 73,576,817 (GRCm39) missense probably damaging 0.98
R7626:Unc13c UTSW 9 73,641,799 (GRCm39) missense probably damaging 1.00
R7639:Unc13c UTSW 9 73,840,450 (GRCm39) missense probably damaging 0.99
R7657:Unc13c UTSW 9 73,441,185 (GRCm39) splice site probably null
R7665:Unc13c UTSW 9 73,587,756 (GRCm39) missense probably benign 0.28
R7704:Unc13c UTSW 9 73,606,494 (GRCm39) missense probably benign 0.27
R7776:Unc13c UTSW 9 73,602,232 (GRCm39) missense probably damaging 1.00
R7811:Unc13c UTSW 9 73,600,553 (GRCm39) missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73,388,391 (GRCm39) missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73,840,596 (GRCm39) missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73,602,159 (GRCm39) missense probably damaging 1.00
R7924:Unc13c UTSW 9 73,641,690 (GRCm39) missense probably benign 0.05
R8047:Unc13c UTSW 9 73,719,636 (GRCm39) nonsense probably null
R8167:Unc13c UTSW 9 73,643,985 (GRCm39) missense probably damaging 0.99
R8202:Unc13c UTSW 9 73,643,844 (GRCm39) missense probably damaging 1.00
R8210:Unc13c UTSW 9 73,392,220 (GRCm39) missense probably benign 0.13
R8352:Unc13c UTSW 9 73,838,290 (GRCm39) missense probably damaging 0.99
R8368:Unc13c UTSW 9 73,838,070 (GRCm39) missense probably benign 0.15
R8452:Unc13c UTSW 9 73,838,290 (GRCm39) missense probably damaging 0.99
R8535:Unc13c UTSW 9 73,447,653 (GRCm39) missense probably benign
R8677:Unc13c UTSW 9 73,840,243 (GRCm39) missense probably benign 0.00
R8700:Unc13c UTSW 9 73,479,679 (GRCm39) missense probably benign 0.44
R8848:Unc13c UTSW 9 73,433,263 (GRCm39) missense probably benign
R8902:Unc13c UTSW 9 73,656,830 (GRCm39) missense probably damaging 0.97
R8953:Unc13c UTSW 9 73,840,044 (GRCm39) missense probably benign 0.00
R8961:Unc13c UTSW 9 73,839,524 (GRCm39) missense probably benign 0.06
R9015:Unc13c UTSW 9 73,453,322 (GRCm39) missense probably benign
R9114:Unc13c UTSW 9 73,719,665 (GRCm39) missense probably benign 0.02
R9217:Unc13c UTSW 9 73,485,715 (GRCm39) missense probably damaging 1.00
R9252:Unc13c UTSW 9 73,424,553 (GRCm39) missense possibly damaging 0.80
R9273:Unc13c UTSW 9 73,839,862 (GRCm39) missense possibly damaging 0.96
R9317:Unc13c UTSW 9 73,447,662 (GRCm39) missense possibly damaging 0.88
R9412:Unc13c UTSW 9 73,839,772 (GRCm39) missense probably benign
R9505:Unc13c UTSW 9 73,838,824 (GRCm39) missense probably benign 0.22
R9516:Unc13c UTSW 9 73,392,220 (GRCm39) missense probably damaging 0.99
R9528:Unc13c UTSW 9 73,837,960 (GRCm39) missense possibly damaging 0.48
R9567:Unc13c UTSW 9 73,536,485 (GRCm39) missense probably damaging 0.99
R9756:Unc13c UTSW 9 73,839,526 (GRCm39) missense probably benign 0.23
R9783:Unc13c UTSW 9 73,392,227 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCAAGTCCATGACTGGTCGG -3'
(R):5'- AAGCCACTGATTTGCTTTGCC -3'

Sequencing Primer
(F):5'- ATGACTGGTCGGCCATCAGTG -3'
(R):5'- GTTCCCGCTCTTAAACTCACAG -3'
Posted On 2016-03-17