Incidental Mutation 'R4876:Map2k2'
ID376892
Institutional Source Beutler Lab
Gene Symbol Map2k2
Ensembl Gene ENSMUSG00000035027
Gene Namemitogen-activated protein kinase kinase 2
SynonymsPrkmk2, MEK2, MAP kinase/Erk kinase
MMRRC Submission 042485-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4876 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81105915-81133975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81115113 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 131 (V131M)
Ref Sequence ENSEMBL: ENSMUSP00000121111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048223] [ENSMUST00000105331] [ENSMUST00000136743] [ENSMUST00000143517] [ENSMUST00000220329]
Predicted Effect probably damaging
Transcript: ENSMUST00000048223
AA Change: V131M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137918
Gene: ENSMUSG00000035027
AA Change: V131M

DomainStartEndE-ValueType
low complexity region 36 52 N/A INTRINSIC
Pfam:Pkinase_Tyr 72 191 1.2e-10 PFAM
Pfam:Pkinase 72 196 5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105331
AA Change: V131M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100968
Gene: ENSMUSG00000035027
AA Change: V131M

DomainStartEndE-ValueType
low complexity region 36 52 N/A INTRINSIC
S_TKc 72 369 8.75e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123888
Predicted Effect probably damaging
Transcript: ENSMUST00000136743
AA Change: V34M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117567
Gene: ENSMUSG00000035027
AA Change: V34M

DomainStartEndE-ValueType
Pfam:Pkinase 1 85 5.8e-14 PFAM
Pfam:Pkinase_Tyr 1 85 6.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143517
AA Change: V131M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121111
Gene: ENSMUSG00000035027
AA Change: V131M

DomainStartEndE-ValueType
low complexity region 36 52 N/A INTRINSIC
S_TKc 72 370 1.24e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220329
Meta Mutation Damage Score 0.8393 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is known to play a critical role in mitogen growth factor signal transduction. It phosphorylates and thus activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, mental retardation, and distinctive facial features similar to those found in Noonan syndrome. The inhibition or degradation of this kinase is also found to be involved in the pathogenesis of Yersinia and anthrax. A pseudogene, which is located on chromosome 7, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are viable, fertile, and apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C T 9: 94,537,577 R100H probably damaging Het
4930562C15Rik T C 16: 4,849,672 F309S unknown Het
9530053A07Rik A T 7: 28,142,800 probably benign Het
A630001G21Rik C T 1: 85,719,040 V167M probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano4 A G 10: 89,112,835 F138L probably damaging Het
Aoc1 T C 6: 48,906,747 V519A possibly damaging Het
Arhgef37 A T 18: 61,498,239 Y558* probably null Het
Atxn3 T A 12: 101,948,379 S29C probably damaging Het
Bbs2 T C 8: 94,070,160 probably benign Het
BC052040 A C 2: 115,670,058 H159P probably damaging Het
Bicral A T 17: 46,825,576 I236N probably damaging Het
Cabcoco1 A G 10: 68,541,769 V30A probably benign Het
Cap2 A G 13: 46,531,021 M1V probably null Het
Ccdc153 T C 9: 44,241,008 M1T probably null Het
Ccnf A T 17: 24,230,337 V489D probably damaging Het
Cntnap3 T C 13: 64,787,706 T448A probably benign Het
Cpa4 G A 6: 30,590,815 D371N probably benign Het
Csl T A 10: 99,758,540 Y221F possibly damaging Het
Dalrd3 T C 9: 108,571,436 probably benign Het
Dennd4a T A 9: 64,896,590 N1070K probably benign Het
Dmwd A T 7: 19,080,547 D374V probably damaging Het
Eea1 G T 10: 95,995,613 A189S probably benign Het
Fasn A G 11: 120,812,312 V1629A probably damaging Het
Fndc1 T C 17: 7,771,639 D1075G unknown Het
Fsip2 A G 2: 82,974,858 N507S possibly damaging Het
Gabra5 T G 7: 57,413,665 E337A probably damaging Het
Gsg1l A G 7: 125,891,669 Y288H probably benign Het
H2-M11 A T 17: 36,547,509 D65V probably benign Het
Hmgxb3 A T 18: 61,146,534 C736S possibly damaging Het
Hsd3b3 A T 3: 98,742,644 I121N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Il16 A C 7: 83,673,094 S338A probably benign Het
Itpr1 G A 6: 108,482,906 A2054T probably damaging Het
Lamp3 T A 16: 19,655,470 I385F probably damaging Het
Limch1 G A 5: 66,881,927 V66I possibly damaging Het
Lmod2 A G 6: 24,604,279 R418G probably benign Het
Ly6g6c A T 17: 35,069,440 D96V probably damaging Het
Mapk9 T C 11: 49,854,325 V22A probably damaging Het
Mettl2 T C 11: 105,129,068 I177T probably damaging Het
Mob4 C T 1: 55,152,836 probably benign Het
Mybpc1 T C 10: 88,522,991 I1113V probably benign Het
Mybpc1 A T 10: 88,536,424 N781K probably benign Het
Myom1 A G 17: 71,077,410 T707A probably damaging Het
Ncam2 G A 16: 81,490,346 A383T probably benign Het
Nomo1 T C 7: 46,066,491 S761P probably damaging Het
Nsd3 T A 8: 25,691,134 S921T possibly damaging Het
Olfr268-ps1 C G 2: 111,844,695 noncoding transcript Het
Olfr934 A T 9: 38,982,626 C139* probably null Het
Olfr985 C T 9: 40,127,218 V248I probably damaging Het
Omp A T 7: 98,145,026 D131E probably benign Het
Pard3 T C 8: 127,561,469 probably benign Het
Parg A G 14: 32,271,668 T286A probably damaging Het
Parp1 T A 1: 180,569,035 M1K probably null Het
Pclo T A 5: 14,811,680 S4882R unknown Het
Pcnx2 C T 8: 125,772,108 E1551K probably damaging Het
Pcyox1l A G 18: 61,699,494 Y161H probably damaging Het
Pdzd8 A T 19: 59,300,804 C721* probably null Het
Piwil4 T C 9: 14,740,465 D90G probably benign Het
Plxdc2 T A 2: 16,703,318 C306S probably damaging Het
Plxna2 T A 1: 194,643,775 F6I probably benign Het
Prkaa1 T C 15: 5,174,405 M265T probably benign Het
Prrc2b T C 2: 32,214,200 V1230A probably benign Het
Rfx2 T C 17: 56,784,706 E329G probably benign Het
Scg2 T C 1: 79,435,919 I322M probably damaging Het
Scly T A 1: 91,320,128 N399K probably damaging Het
Sec23b T A 2: 144,586,361 probably null Het
Sephs2 A T 7: 127,273,047 Y291* probably null Het
Slc45a3 T C 1: 131,981,547 I494T possibly damaging Het
Slc6a21 C A 7: 45,280,111 Y76* probably null Het
Slfn14 T A 11: 83,276,272 I806L possibly damaging Het
Slfn4 T A 11: 83,187,018 S211T probably benign Het
Sptbn4 A G 7: 27,372,152 V1624A probably damaging Het
Sugp1 T A 8: 70,071,184 M567K probably damaging Het
Tmem121 A T 12: 113,188,728 M189L probably benign Het
Tmem201 A G 4: 149,722,270 S444P probably damaging Het
Tmem63a T C 1: 180,973,186 V744A probably benign Het
Tnrc18 G A 5: 142,731,625 S2358F unknown Het
Ubash3b A G 9: 41,018,109 V404A probably benign Het
Unc13c A T 9: 73,749,539 C1127S probably damaging Het
Unc5a T C 13: 54,997,229 V253A probably benign Het
Vmn1r-ps123 C T 13: 22,996,365 noncoding transcript Het
Wdr74 A G 19: 8,739,485 E253G possibly damaging Het
Wwox T C 8: 114,448,248 Y107H probably damaging Het
Zdhhc22 A T 12: 86,988,238 Y147N probably damaging Het
Zfp131 T C 13: 119,788,955 H44R possibly damaging Het
Zfp235 A G 7: 24,140,959 T268A probably benign Het
Zfp280d T C 9: 72,298,858 probably benign Het
Zfp358 T C 8: 3,496,170 S251P probably damaging Het
Other mutations in Map2k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Map2k2 APN 10 81121073 missense probably damaging 0.99
IGL00825:Map2k2 APN 10 81118218 missense probably benign 0.12
IGL00826:Map2k2 APN 10 81118218 missense probably benign 0.12
R0972:Map2k2 UTSW 10 81119648 missense probably benign 0.00
R1772:Map2k2 UTSW 10 81121100 missense probably damaging 1.00
R2202:Map2k2 UTSW 10 81119379 missense probably damaging 0.98
R2203:Map2k2 UTSW 10 81119379 missense probably damaging 0.98
R4010:Map2k2 UTSW 10 81108935 missense probably damaging 1.00
R6905:Map2k2 UTSW 10 81108867 missense probably damaging 1.00
R7073:Map2k2 UTSW 10 81106183 missense probably benign
R7741:Map2k2 UTSW 10 81121043 missense probably benign
R7832:Map2k2 UTSW 10 81118206 missense possibly damaging 0.80
R7915:Map2k2 UTSW 10 81118206 missense possibly damaging 0.80
R8052:Map2k2 UTSW 10 81115066 missense probably damaging 1.00
RF004:Map2k2 UTSW 10 81115168 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AATGACTTCAGGACTGGGGC -3'
(R):5'- TTACCTAGAAAGCGAGGAGTGC -3'

Sequencing Primer
(F):5'- ACTTCAGGACTGGGGCTTAAG -3'
(R):5'- AGTGCAGCTCATCTGAAGCTG -3'
Posted On2016-03-17