Mutagenetix > Incidental Mutation

Incidental Mutation 'R0295:Gria4'

37690

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

038512-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.633) question?

Stock #

R0295 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4793840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 73 (T73A)

Ref Sequence

ENSEMBL: ENSMUSP00000129316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]

AlphaFold

Q9Z2W8

Predicted Effect

probably benign
Transcript: ENSMUST00000027020
AA Change: T73A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: T73A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063508
AA Change: T73A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: T73A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163309
AA Change: T73A

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: T73A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3.2e-62	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212533
AA Change: T73A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

Meta Mutation Damage Score

0.0923

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	A	T	2: 91,282,594	I173N	probably damaging	Het
2610028H24Rik	G	A	10: 76,454,808	S127N	probably damaging	Het
Abcc8	T	C	7: 46,118,054	R953G	probably benign	Het
Adamtsl3	T	A	7: 82,548,005		probably null	Het
Adh4	A	G	3: 138,429,076	D337G	probably damaging	Het
Apob	T	A	12: 8,002,181	Y1207*	probably null	Het
Birc6	T	C	17: 74,613,362		probably benign	Het
Bms1	A	G	6: 118,389,337	I1065T	probably benign	Het
Cacna1i	T	A	15: 80,356,211	L378Q	probably damaging	Het
Ccdc127	C	A	13: 74,356,870	P179H	probably damaging	Het
Ccdc18	A	T	5: 108,173,789	K586N	probably damaging	Het
Cep290	A	C	10: 100,537,821	E1321A	probably damaging	Het
Ctc1	A	G	11: 69,030,588	K682E	possibly damaging	Het
Cux1	A	C	5: 136,313,212	V442G	probably benign	Het
Dph2	A	T	4: 117,890,930	V150E	possibly damaging	Het
Etv6	A	G	6: 134,266,275	D331G	probably benign	Het
Fbxo42	A	G	4: 141,200,497	D696G	probably damaging	Het
Fbxo8	G	A	8: 56,590,074	D198N	probably benign	Het
H2afj	C	G	6: 136,808,604	R89G	probably damaging	Het
Ifng	G	T	10: 118,441,249	S32I	possibly damaging	Het
Ildr1	A	G	16: 36,709,477		probably null	Het
Knl1	A	C	2: 119,088,839	D1824A	probably damaging	Het
Lamp3	A	T	16: 19,701,108	Y108*	probably null	Het
Lcp1	A	G	14: 75,199,420	I69V	probably null	Het
Lrp6	A	T	6: 134,457,693	V1349E	probably benign	Het
Lrrcc1	A	T	3: 14,565,849	E1009D	probably benign	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Med14	G	C	X: 12,685,748	R1223G	probably damaging	Het
Mesd	C	T	7: 83,897,865	Q179*	probably null	Het
Myh7	A	G	14: 54,984,821		probably benign	Het
Myo6	T	C	9: 80,283,579	I804T	probably damaging	Het
Neb	T	C	2: 52,284,285	I1521V	possibly damaging	Het
Nosip	T	A	7: 45,076,916	I249N	probably damaging	Het
Nostrin	A	C	2: 69,179,416	E296A	probably benign	Het
Olfr1280	T	A	2: 111,316,154	V225D	probably damaging	Het
Olfr136	A	T	17: 38,335,291	I45F	probably damaging	Het
Olfr491	T	G	7: 108,317,685	S264A	probably benign	Het
Olfr624	T	C	7: 103,670,311	H240R	probably damaging	Het
Oprk1	T	C	1: 5,598,850	L173S	possibly damaging	Het
Pdzd7	A	G	19: 45,037,072	V328A	probably benign	Het
Podxl2	A	T	6: 88,849,678	S215R	probably benign	Het
Prss36	T	G	7: 127,935,855	T418P	possibly damaging	Het
Ralgps2	T	A	1: 156,823,985		probably benign	Het
Rasa2	T	C	9: 96,545,810		probably null	Het
Rgs1	A	T	1: 144,245,486	I149N	probably damaging	Het
Rgs16	A	G	1: 153,743,737	E163G	probably damaging	Het
Rnf121	A	G	7: 102,035,346	F120S	possibly damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slfn8	A	T	11: 83,003,343	Y823*	probably null	Het
Spdl1	A	T	11: 34,813,343	N554K	possibly damaging	Het
St6gal1	T	A	16: 23,356,203		probably benign	Het
Tet3	G	A	6: 83,369,139	P1304S	probably benign	Het
Timm29	T	C	9: 21,593,076		probably null	Het
Tpcn1	T	A	5: 120,539,060	I687F	probably damaging	Het
Trim46	A	G	3: 89,245,113		probably benign	Het
Ttc23	T	A	7: 67,669,852		probably benign	Het
Ttll6	G	T	11: 96,154,714	V586L	probably benign	Het
Ttn	A	T	2: 76,758,611		probably benign	Het
Uba3	A	T	6: 97,191,583	H160Q	possibly damaging	Het
Usp32	A	G	11: 85,053,692	S316P	probably damaging	Het
Vcan	T	C	13: 89,712,191	I352M	probably benign	Het
Zcwpw1	G	T	5: 137,817,472	L412F	probably damaging	Het
Zfp292	A	T	4: 34,806,281	N2254K	probably damaging	Het
Zscan4e	A	G	7: 11,307,616	S138P	probably damaging	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
R8478:Gria4	UTSW	9	4793882	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424347	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424351	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4456106	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4795189	missense	possibly damaging	0.92
R8888:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R8895:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R9160:Gria4	UTSW	9	4424412	missense	probably damaging	1.00
R9498:Gria4	UTSW	9	4503560	critical splice donor site	probably null
R9743:Gria4	UTSW	9	4464457	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AAAGGAAGGCAGGCACTTACTTCAG -3'
(R):5'- GCAGCCCCTATGATATGGCAAAGAG -3'

Sequencing Primer
(F):5'- caaggaagggtggaaggaag -3'
(R):5'- TTGACAGTCATGGAACTAGGTGTAAC -3'

Posted On

2013-05-23