Incidental Mutation 'R4876:Cap2'
ID 376908
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene Name cyclase associated actin cytoskeleton regulatory protein 2
Synonyms 2810452G09Rik
MMRRC Submission 042485-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R4876 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 46655379-46803757 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to G at 46684497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000153125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
AlphaFold Q9CYT6
Predicted Effect probably benign
Transcript: ENSMUST00000021802
AA Change: M56V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: M56V

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119341
AA Change: M56V

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373
AA Change: M56V

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000225824
AA Change: M1V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1053 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,536 (GRCm39) F309S unknown Het
A630001G21Rik C T 1: 85,646,761 (GRCm39) V167M probably damaging Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Ano4 A G 10: 88,948,697 (GRCm39) F138L probably damaging Het
Aoc1 T C 6: 48,883,681 (GRCm39) V519A possibly damaging Het
Arhgef37 A T 18: 61,631,310 (GRCm39) Y558* probably null Het
Atxn3 T A 12: 101,914,638 (GRCm39) S29C probably damaging Het
Bbs2 T C 8: 94,796,788 (GRCm39) probably benign Het
Bicral A T 17: 47,136,502 (GRCm39) I236N probably damaging Het
Cabcoco1 A G 10: 68,377,599 (GRCm39) V30A probably benign Het
Ccdc153 T C 9: 44,152,305 (GRCm39) M1T probably null Het
Ccnf A T 17: 24,449,311 (GRCm39) V489D probably damaging Het
Cdin1 A C 2: 115,500,539 (GRCm39) H159P probably damaging Het
Cntnap3 T C 13: 64,935,520 (GRCm39) T448A probably benign Het
Cpa4 G A 6: 30,590,814 (GRCm39) D371N probably benign Het
Csl T A 10: 99,594,402 (GRCm39) Y221F possibly damaging Het
Dalrd3 T C 9: 108,448,635 (GRCm39) probably benign Het
Dennd4a T A 9: 64,803,872 (GRCm39) N1070K probably benign Het
Dipk2a C T 9: 94,419,630 (GRCm39) R100H probably damaging Het
Dmwd A T 7: 18,814,472 (GRCm39) D374V probably damaging Het
Eea1 G T 10: 95,831,475 (GRCm39) A189S probably benign Het
Fasn A G 11: 120,703,138 (GRCm39) V1629A probably damaging Het
Fcgbpl1 A T 7: 27,842,225 (GRCm39) probably benign Het
Fndc1 T C 17: 7,990,471 (GRCm39) D1075G unknown Het
Fsip2 A G 2: 82,805,202 (GRCm39) N507S possibly damaging Het
Gabra5 T G 7: 57,063,413 (GRCm39) E337A probably damaging Het
Gsg1l A G 7: 125,490,841 (GRCm39) Y288H probably benign Het
H2-M11 A T 17: 36,858,401 (GRCm39) D65V probably benign Het
Hmgxb3 A T 18: 61,279,606 (GRCm39) C736S possibly damaging Het
Hsd3b3 A T 3: 98,649,960 (GRCm39) I121N probably damaging Het
Ikbke GCC G 1: 131,203,004 (GRCm39) probably null Het
Il16 A C 7: 83,322,302 (GRCm39) S338A probably benign Het
Itpr1 G A 6: 108,459,867 (GRCm39) A2054T probably damaging Het
Lamp3 T A 16: 19,474,220 (GRCm39) I385F probably damaging Het
Limch1 G A 5: 67,039,270 (GRCm39) V66I possibly damaging Het
Lmod2 A G 6: 24,604,278 (GRCm39) R418G probably benign Het
Ly6g6c A T 17: 35,288,416 (GRCm39) D96V probably damaging Het
Map2k2 G A 10: 80,950,947 (GRCm39) V131M probably damaging Het
Mapk9 T C 11: 49,745,152 (GRCm39) V22A probably damaging Het
Mettl2 T C 11: 105,019,894 (GRCm39) I177T probably damaging Het
Mob4 C T 1: 55,191,995 (GRCm39) probably benign Het
Mybpc1 A T 10: 88,372,286 (GRCm39) N781K probably benign Het
Mybpc1 T C 10: 88,358,853 (GRCm39) I1113V probably benign Het
Myom1 A G 17: 71,384,405 (GRCm39) T707A probably damaging Het
Ncam2 G A 16: 81,287,234 (GRCm39) A383T probably benign Het
Nomo1 T C 7: 45,715,915 (GRCm39) S761P probably damaging Het
Nsd3 T A 8: 26,181,161 (GRCm39) S921T possibly damaging Het
Omp A T 7: 97,794,233 (GRCm39) D131E probably benign Het
Or10d1c A T 9: 38,893,922 (GRCm39) C139* probably null Het
Or4f7d-ps1 C G 2: 111,675,040 (GRCm39) noncoding transcript Het
Or8d4 C T 9: 40,038,514 (GRCm39) V248I probably damaging Het
Pard3 T C 8: 128,287,950 (GRCm39) probably benign Het
Parg A G 14: 31,993,625 (GRCm39) T286A probably damaging Het
Parp1 T A 1: 180,396,600 (GRCm39) M1K probably null Het
Pclo T A 5: 14,861,694 (GRCm39) S4882R unknown Het
Pcnx2 C T 8: 126,498,847 (GRCm39) E1551K probably damaging Het
Pcyox1l A G 18: 61,832,565 (GRCm39) Y161H probably damaging Het
Pdzd8 A T 19: 59,289,236 (GRCm39) C721* probably null Het
Piwil4 T C 9: 14,651,761 (GRCm39) D90G probably benign Het
Plxdc2 T A 2: 16,708,129 (GRCm39) C306S probably damaging Het
Plxna2 T A 1: 194,326,083 (GRCm39) F6I probably benign Het
Prkaa1 T C 15: 5,203,886 (GRCm39) M265T probably benign Het
Prrc2b T C 2: 32,104,212 (GRCm39) V1230A probably benign Het
Rfx2 T C 17: 57,091,706 (GRCm39) E329G probably benign Het
Scg2 T C 1: 79,413,636 (GRCm39) I322M probably damaging Het
Scly T A 1: 91,247,850 (GRCm39) N399K probably damaging Het
Sec23b T A 2: 144,428,281 (GRCm39) probably null Het
Sephs2 A T 7: 126,872,219 (GRCm39) Y291* probably null Het
Slc45a3 T C 1: 131,909,285 (GRCm39) I494T possibly damaging Het
Slc6a21 C A 7: 44,929,535 (GRCm39) Y76* probably null Het
Slfn14 T A 11: 83,167,098 (GRCm39) I806L possibly damaging Het
Slfn4 T A 11: 83,077,844 (GRCm39) S211T probably benign Het
Sptbn4 A G 7: 27,071,577 (GRCm39) V1624A probably damaging Het
Sugp1 T A 8: 70,523,834 (GRCm39) M567K probably damaging Het
Tmem121 A T 12: 113,152,348 (GRCm39) M189L probably benign Het
Tmem201 A G 4: 149,806,727 (GRCm39) S444P probably damaging Het
Tmem63a T C 1: 180,800,751 (GRCm39) V744A probably benign Het
Tnrc18 G A 5: 142,717,380 (GRCm39) S2358F unknown Het
Ubash3b A G 9: 40,929,405 (GRCm39) V404A probably benign Het
Unc13c A T 9: 73,656,821 (GRCm39) C1127S probably damaging Het
Unc5a T C 13: 55,145,042 (GRCm39) V253A probably benign Het
Vmn1r-ps123 C T 13: 23,180,535 (GRCm39) noncoding transcript Het
Wdr74 A G 19: 8,716,849 (GRCm39) E253G possibly damaging Het
Wwox T C 8: 115,174,988 (GRCm39) Y107H probably damaging Het
Zdhhc22 A T 12: 87,035,012 (GRCm39) Y147N probably damaging Het
Zfp131 T C 13: 120,250,491 (GRCm39) H44R possibly damaging Het
Zfp235 A G 7: 23,840,384 (GRCm39) T268A probably benign Het
Zfp280d T C 9: 72,206,140 (GRCm39) probably benign Het
Zfp358 T C 8: 3,546,170 (GRCm39) S251P probably damaging Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46,793,425 (GRCm39) splice site probably benign
IGL01927:Cap2 APN 13 46,789,109 (GRCm39) missense probably benign 0.03
IGL02213:Cap2 APN 13 46,789,087 (GRCm39) splice site probably benign
IGL02511:Cap2 APN 13 46,684,498 (GRCm39) start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46,678,968 (GRCm39) missense probably benign 0.00
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0385:Cap2 UTSW 13 46,714,023 (GRCm39) missense probably damaging 1.00
R0387:Cap2 UTSW 13 46,713,992 (GRCm39) missense probably damaging 0.99
R0712:Cap2 UTSW 13 46,768,837 (GRCm39) splice site probably null
R1489:Cap2 UTSW 13 46,763,111 (GRCm39) missense probably damaging 1.00
R1666:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1668:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1676:Cap2 UTSW 13 46,791,335 (GRCm39) missense probably damaging 1.00
R1756:Cap2 UTSW 13 46,684,489 (GRCm39) missense probably benign 0.11
R1822:Cap2 UTSW 13 46,768,823 (GRCm39) missense probably benign 0.03
R1867:Cap2 UTSW 13 46,793,555 (GRCm39) missense probably damaging 1.00
R1972:Cap2 UTSW 13 46,791,375 (GRCm39) missense probably damaging 0.98
R1990:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46,713,978 (GRCm39) critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46,793,317 (GRCm39) missense probably benign 0.20
R4024:Cap2 UTSW 13 46,791,317 (GRCm39) splice site probably benign
R4554:Cap2 UTSW 13 46,789,250 (GRCm39) missense probably damaging 1.00
R4748:Cap2 UTSW 13 46,793,302 (GRCm39) missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46,763,586 (GRCm39) missense probably damaging 0.99
R4902:Cap2 UTSW 13 46,684,501 (GRCm39) missense probably damaging 0.99
R5320:Cap2 UTSW 13 46,801,840 (GRCm39) makesense probably null
R5666:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R5670:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R6086:Cap2 UTSW 13 46,789,188 (GRCm39) missense probably damaging 1.00
R6728:Cap2 UTSW 13 46,793,335 (GRCm39) missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46,800,101 (GRCm39) missense probably damaging 1.00
R7785:Cap2 UTSW 13 46,789,224 (GRCm39) missense probably benign
R7889:Cap2 UTSW 13 46,800,051 (GRCm39) missense probably damaging 0.99
R8065:Cap2 UTSW 13 46,791,337 (GRCm39) missense probably damaging 1.00
R8205:Cap2 UTSW 13 46,768,739 (GRCm39) missense probably damaging 1.00
R8425:Cap2 UTSW 13 46,763,208 (GRCm39) missense probably damaging 0.98
R8731:Cap2 UTSW 13 46,800,006 (GRCm39) missense probably benign 0.00
R8738:Cap2 UTSW 13 46,684,548 (GRCm39) missense probably benign 0.00
R9320:Cap2 UTSW 13 46,768,818 (GRCm39) missense probably benign 0.04
R9491:Cap2 UTSW 13 46,791,366 (GRCm39) missense possibly damaging 0.92
R9686:Cap2 UTSW 13 46,678,926 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGGCCAAGGGGATTTTC -3'
(R):5'- GAATTCCTGGTACCTTCTGATGC -3'

Sequencing Primer
(F):5'- TTCCGGAGCCATCGTAAATG -3'
(R):5'- CTGGTACCTTCTGATGCTTTAATTAG -3'
Posted On 2016-03-17