Incidental Mutation 'R4876:Cntnap3'
ID 376910
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
MMRRC Submission 042485-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R4876 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 64883996-65051769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64935520 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 448 (T448A)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect probably benign
Transcript: ENSMUST00000091554
AA Change: T448A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: T448A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,536 (GRCm39) F309S unknown Het
A630001G21Rik C T 1: 85,646,761 (GRCm39) V167M probably damaging Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Ano4 A G 10: 88,948,697 (GRCm39) F138L probably damaging Het
Aoc1 T C 6: 48,883,681 (GRCm39) V519A possibly damaging Het
Arhgef37 A T 18: 61,631,310 (GRCm39) Y558* probably null Het
Atxn3 T A 12: 101,914,638 (GRCm39) S29C probably damaging Het
Bbs2 T C 8: 94,796,788 (GRCm39) probably benign Het
Bicral A T 17: 47,136,502 (GRCm39) I236N probably damaging Het
Cabcoco1 A G 10: 68,377,599 (GRCm39) V30A probably benign Het
Cap2 A G 13: 46,684,497 (GRCm39) M1V probably null Het
Ccdc153 T C 9: 44,152,305 (GRCm39) M1T probably null Het
Ccnf A T 17: 24,449,311 (GRCm39) V489D probably damaging Het
Cdin1 A C 2: 115,500,539 (GRCm39) H159P probably damaging Het
Cpa4 G A 6: 30,590,814 (GRCm39) D371N probably benign Het
Csl T A 10: 99,594,402 (GRCm39) Y221F possibly damaging Het
Dalrd3 T C 9: 108,448,635 (GRCm39) probably benign Het
Dennd4a T A 9: 64,803,872 (GRCm39) N1070K probably benign Het
Dipk2a C T 9: 94,419,630 (GRCm39) R100H probably damaging Het
Dmwd A T 7: 18,814,472 (GRCm39) D374V probably damaging Het
Eea1 G T 10: 95,831,475 (GRCm39) A189S probably benign Het
Fasn A G 11: 120,703,138 (GRCm39) V1629A probably damaging Het
Fcgbpl1 A T 7: 27,842,225 (GRCm39) probably benign Het
Fndc1 T C 17: 7,990,471 (GRCm39) D1075G unknown Het
Fsip2 A G 2: 82,805,202 (GRCm39) N507S possibly damaging Het
Gabra5 T G 7: 57,063,413 (GRCm39) E337A probably damaging Het
Gsg1l A G 7: 125,490,841 (GRCm39) Y288H probably benign Het
H2-M11 A T 17: 36,858,401 (GRCm39) D65V probably benign Het
Hmgxb3 A T 18: 61,279,606 (GRCm39) C736S possibly damaging Het
Hsd3b3 A T 3: 98,649,960 (GRCm39) I121N probably damaging Het
Ikbke GCC G 1: 131,203,004 (GRCm39) probably null Het
Il16 A C 7: 83,322,302 (GRCm39) S338A probably benign Het
Itpr1 G A 6: 108,459,867 (GRCm39) A2054T probably damaging Het
Lamp3 T A 16: 19,474,220 (GRCm39) I385F probably damaging Het
Limch1 G A 5: 67,039,270 (GRCm39) V66I possibly damaging Het
Lmod2 A G 6: 24,604,278 (GRCm39) R418G probably benign Het
Ly6g6c A T 17: 35,288,416 (GRCm39) D96V probably damaging Het
Map2k2 G A 10: 80,950,947 (GRCm39) V131M probably damaging Het
Mapk9 T C 11: 49,745,152 (GRCm39) V22A probably damaging Het
Mettl2 T C 11: 105,019,894 (GRCm39) I177T probably damaging Het
Mob4 C T 1: 55,191,995 (GRCm39) probably benign Het
Mybpc1 A T 10: 88,372,286 (GRCm39) N781K probably benign Het
Mybpc1 T C 10: 88,358,853 (GRCm39) I1113V probably benign Het
Myom1 A G 17: 71,384,405 (GRCm39) T707A probably damaging Het
Ncam2 G A 16: 81,287,234 (GRCm39) A383T probably benign Het
Nomo1 T C 7: 45,715,915 (GRCm39) S761P probably damaging Het
Nsd3 T A 8: 26,181,161 (GRCm39) S921T possibly damaging Het
Omp A T 7: 97,794,233 (GRCm39) D131E probably benign Het
Or10d1c A T 9: 38,893,922 (GRCm39) C139* probably null Het
Or4f7d-ps1 C G 2: 111,675,040 (GRCm39) noncoding transcript Het
Or8d4 C T 9: 40,038,514 (GRCm39) V248I probably damaging Het
Pard3 T C 8: 128,287,950 (GRCm39) probably benign Het
Parg A G 14: 31,993,625 (GRCm39) T286A probably damaging Het
Parp1 T A 1: 180,396,600 (GRCm39) M1K probably null Het
Pclo T A 5: 14,861,694 (GRCm39) S4882R unknown Het
Pcnx2 C T 8: 126,498,847 (GRCm39) E1551K probably damaging Het
Pcyox1l A G 18: 61,832,565 (GRCm39) Y161H probably damaging Het
Pdzd8 A T 19: 59,289,236 (GRCm39) C721* probably null Het
Piwil4 T C 9: 14,651,761 (GRCm39) D90G probably benign Het
Plxdc2 T A 2: 16,708,129 (GRCm39) C306S probably damaging Het
Plxna2 T A 1: 194,326,083 (GRCm39) F6I probably benign Het
Prkaa1 T C 15: 5,203,886 (GRCm39) M265T probably benign Het
Prrc2b T C 2: 32,104,212 (GRCm39) V1230A probably benign Het
Rfx2 T C 17: 57,091,706 (GRCm39) E329G probably benign Het
Scg2 T C 1: 79,413,636 (GRCm39) I322M probably damaging Het
Scly T A 1: 91,247,850 (GRCm39) N399K probably damaging Het
Sec23b T A 2: 144,428,281 (GRCm39) probably null Het
Sephs2 A T 7: 126,872,219 (GRCm39) Y291* probably null Het
Slc45a3 T C 1: 131,909,285 (GRCm39) I494T possibly damaging Het
Slc6a21 C A 7: 44,929,535 (GRCm39) Y76* probably null Het
Slfn14 T A 11: 83,167,098 (GRCm39) I806L possibly damaging Het
Slfn4 T A 11: 83,077,844 (GRCm39) S211T probably benign Het
Sptbn4 A G 7: 27,071,577 (GRCm39) V1624A probably damaging Het
Sugp1 T A 8: 70,523,834 (GRCm39) M567K probably damaging Het
Tmem121 A T 12: 113,152,348 (GRCm39) M189L probably benign Het
Tmem201 A G 4: 149,806,727 (GRCm39) S444P probably damaging Het
Tmem63a T C 1: 180,800,751 (GRCm39) V744A probably benign Het
Tnrc18 G A 5: 142,717,380 (GRCm39) S2358F unknown Het
Ubash3b A G 9: 40,929,405 (GRCm39) V404A probably benign Het
Unc13c A T 9: 73,656,821 (GRCm39) C1127S probably damaging Het
Unc5a T C 13: 55,145,042 (GRCm39) V253A probably benign Het
Vmn1r-ps123 C T 13: 23,180,535 (GRCm39) noncoding transcript Het
Wdr74 A G 19: 8,716,849 (GRCm39) E253G possibly damaging Het
Wwox T C 8: 115,174,988 (GRCm39) Y107H probably damaging Het
Zdhhc22 A T 12: 87,035,012 (GRCm39) Y147N probably damaging Het
Zfp131 T C 13: 120,250,491 (GRCm39) H44R possibly damaging Het
Zfp235 A G 7: 23,840,384 (GRCm39) T268A probably benign Het
Zfp280d T C 9: 72,206,140 (GRCm39) probably benign Het
Zfp358 T C 8: 3,546,170 (GRCm39) S251P probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64,920,545 (GRCm39) missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64,893,619 (GRCm39) splice site probably benign
IGL00976:Cntnap3 APN 13 64,942,166 (GRCm39) missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64,935,651 (GRCm39) missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64,905,115 (GRCm39) missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64,946,922 (GRCm39) missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64,946,878 (GRCm39) splice site probably benign
IGL02133:Cntnap3 APN 13 64,899,487 (GRCm39) splice site probably benign
IGL02251:Cntnap3 APN 13 64,909,850 (GRCm39) missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64,905,225 (GRCm39) missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64,899,565 (GRCm39) missense probably benign
IGL02456:Cntnap3 APN 13 64,946,872 (GRCm39) splice site probably benign
IGL02589:Cntnap3 APN 13 64,940,244 (GRCm39) missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64,919,946 (GRCm39) missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64,905,223 (GRCm39) missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64,888,839 (GRCm39) missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64,929,559 (GRCm39) missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 65,035,582 (GRCm39) nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64,905,024 (GRCm39) missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64,905,250 (GRCm39) splice site probably benign
R0422:Cntnap3 UTSW 13 64,905,099 (GRCm39) missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64,926,690 (GRCm39) missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64,909,859 (GRCm39) missense probably benign 0.01
R0499:Cntnap3 UTSW 13 65,006,492 (GRCm39) missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64,909,814 (GRCm39) missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64,906,228 (GRCm39) missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64,905,211 (GRCm39) missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64,935,724 (GRCm39) missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64,906,104 (GRCm39) missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64,909,816 (GRCm39) missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64,888,626 (GRCm39) critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64,888,406 (GRCm39) missense probably benign 0.17
R1905:Cntnap3 UTSW 13 65,051,578 (GRCm39) missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64,906,204 (GRCm39) missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64,942,076 (GRCm39) missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64,888,813 (GRCm39) missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64,896,274 (GRCm39) missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64,926,667 (GRCm39) missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64,926,697 (GRCm39) missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64,926,602 (GRCm39) critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64,926,676 (GRCm39) missense probably benign 0.17
R4994:Cntnap3 UTSW 13 64,909,798 (GRCm39) missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64,942,162 (GRCm39) missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64,909,824 (GRCm39) missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64,909,792 (GRCm39) missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 65,051,572 (GRCm39) missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64,894,552 (GRCm39) missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64,935,769 (GRCm39) missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64,896,391 (GRCm39) missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64,946,994 (GRCm39) missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64,935,583 (GRCm39) missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64,929,702 (GRCm39) missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64,896,373 (GRCm39) missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64,929,539 (GRCm39) critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64,919,776 (GRCm39) missense probably benign
R7425:Cntnap3 UTSW 13 64,906,066 (GRCm39) missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64,919,815 (GRCm39) missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64,920,591 (GRCm39) nonsense probably null
R7810:Cntnap3 UTSW 13 64,941,122 (GRCm39) missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 65,051,587 (GRCm39) missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64,935,681 (GRCm39) missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64,886,479 (GRCm39) missense probably benign 0.31
R8491:Cntnap3 UTSW 13 64,933,157 (GRCm39) missense probably damaging 1.00
R9086:Cntnap3 UTSW 13 64,929,573 (GRCm39) missense probably damaging 1.00
R9087:Cntnap3 UTSW 13 64,899,532 (GRCm39) missense probably damaging 0.96
R9398:Cntnap3 UTSW 13 65,051,648 (GRCm39) missense probably benign 0.41
R9475:Cntnap3 UTSW 13 64,946,949 (GRCm39) missense probably damaging 1.00
R9625:Cntnap3 UTSW 13 65,006,579 (GRCm39) missense probably damaging 1.00
R9679:Cntnap3 UTSW 13 64,899,562 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap3 UTSW 13 64,940,202 (GRCm39) missense probably damaging 0.98
Z1176:Cntnap3 UTSW 13 64,888,686 (GRCm39) frame shift probably null
Z1177:Cntnap3 UTSW 13 64,929,706 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCATTATTGGCTGCATATCACAC -3'
(R):5'- CACAGACAATTCCAGTGACTTTC -3'

Sequencing Primer
(F):5'- CACGTATAAATAGTCCTGAGTAGCC -3'
(R):5'- CAGACAATTCCAGTGACTTTCCTGAG -3'
Posted On 2016-03-17