Mutagenetix > Incidental Mutation

Incidental Mutation 'R4887:Iqca'

376933

Institutional Source

Beutler Lab

Gene Symbol

Iqca

Ensembl Gene

ENSMUSG00000026301

Gene Name

IQ motif containing with AAA domain

Synonyms

MMRRC Submission

041979-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4887 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90042132-90153401 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 90045701 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 783 (T783M)

Ref Sequence

ENSEMBL: ENSMUSP00000148643 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113094] [ENSMUST00000212394]

AlphaFold

Q9CUL5

Predicted Effect

probably damaging
Transcript: ENSMUST00000113094
AA Change: T755M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108717
Gene: ENSMUSG00000026301
AA Change: T755M

Domain	Start	End	E-Value	Type
IQ	205	227	6.97e0	SMART
coiled coil region	340	380	N/A	INTRINSIC
coiled coil region	425	450	N/A	INTRINSIC
low complexity region	464	487	N/A	INTRINSIC
AAA	567	706	1.08e-3	SMART
low complexity region	812	829	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189690

Predicted Effect

probably damaging
Transcript: ENSMUST00000212394
AA Change: T783M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212859

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATPases Associated with diverse cellular Activities (AAA) superfamily. Members of this superfamily, found in all organisms, participate in a large number of cellular processes and contain the ATPase module consisting of an alpha-beta-alpha core domain and the Walker A and B motifs of the P-loop NTPases. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,876,324	I22F	possibly damaging	Het
2310009B15Rik	A	C	1: 138,852,165	Y116*	probably null	Het
4930548H24Rik	A	G	5: 31,486,252	I109V	probably benign	Het
Acer3	T	C	7: 98,257,701	T91A	possibly damaging	Het
Adam12	T	C	7: 134,172,821	K20E	possibly damaging	Het
Adamtsl3	T	C	7: 82,574,614	V275A	possibly damaging	Het
Afg1l	C	T	10: 42,454,378	V98I	probably benign	Het
Alpk1	C	T	3: 127,673,475	G1052R	probably damaging	Het
Anln	A	T	9: 22,380,188	S115T	possibly damaging	Het
Apob	T	A	12: 8,013,099	N3827K	probably damaging	Het
Aqr	G	A	2: 114,150,509	L264F	probably damaging	Het
Arhgap33	T	C	7: 30,532,192	S123G	probably damaging	Het
Arvcf	C	T	16: 18,398,113	R333*	probably null	Het
Brca2	T	A	5: 150,556,937	L2724Q	probably damaging	Het
Btbd11	C	T	10: 85,387,378	T17M	unknown	Het
C2cd6	T	A	1: 59,094,734	T43S	probably benign	Het
Cacna1h	A	G	17: 25,377,287	V1920A	possibly damaging	Het
Capsl	A	T	15: 9,457,772	I26F	possibly damaging	Het
Card10	A	T	15: 78,781,524	V673E	possibly damaging	Het
Ccar1	A	G	10: 62,753,218	S829P	unknown	Het
Cdc42bpa	T	C	1: 180,144,635	M1334T	possibly damaging	Het
Ceacam2	C	T	7: 25,520,832	C267Y	probably benign	Het
Cep68	G	A	11: 20,239,239	T591M	probably benign	Het
Chil4	T	C	3: 106,204,144	K218R	probably benign	Het
Cldn14	G	T	16: 93,919,859	T33K	possibly damaging	Het
Copa	T	A	1: 172,092,276	C140S	probably benign	Het
Coq6	T	C	12: 84,372,296	L358P	probably damaging	Het
Cyfip1	C	T	7: 55,872,068	P40L	probably damaging	Het
Dennd2a	A	C	6: 39,497,159	S414A	probably benign	Het
Dpm1	T	C	2: 168,217,759	N139S	probably benign	Het
Dpp7	T	A	2: 25,352,758		probably null	Het
Ednrb	T	C	14: 103,820,011	I372V	possibly damaging	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Fam135a	G	A	1: 24,024,253	Q1087*	probably null	Het
Fancg	T	C	4: 43,006,866	T275A	probably benign	Het
Fbn1	T	A	2: 125,309,774	H2520L	probably damaging	Het
Fmn2	T	C	1: 174,581,961	S587P	unknown	Het
Foxr2	A	G	X: 153,130,316	Q61R	probably damaging	Het
Frrs1	A	G	3: 116,902,416	*124W	probably null	Het
Gm16432	A	G	1: 178,103,949	Y478C	unknown	Het
Gm7535	T	A	17: 17,911,071		probably benign	Het
Gm884	T	C	11: 103,614,872	H2090R	probably benign	Het
Gm996	G	A	2: 25,579,747	R51C	possibly damaging	Het
Herc3	T	C	6: 58,887,499	V706A	probably damaging	Het
Hist1h4a	T	C	13: 23,760,952	D69G	probably damaging	Het
Hivep3	A	G	4: 120,122,934	E1723G	probably damaging	Het
Igsf9b	A	G	9: 27,322,650	I382V	probably benign	Het
Ints1	G	T	5: 139,771,156	T467N	possibly damaging	Het
Kng1	A	G	16: 23,067,698	K131R	possibly damaging	Het
Krt35	T	C	11: 100,093,130	Y348C	probably damaging	Het
Ldlrad3	A	G	2: 102,113,536	C64R	probably damaging	Het
Lilr4b	C	T	10: 51,484,520	A272V	possibly damaging	Het
Ltn1	A	T	16: 87,398,809	C1276*	probably null	Het
Matn1	G	A	4: 130,952,114	A360T	probably benign	Het
Minpp1	G	A	19: 32,498,384	V306I	probably benign	Het
Mkx	G	A	18: 6,992,904	R127W	probably damaging	Het
Mrpl48	G	T	7: 100,546,409		probably benign	Het
Ms4a2	A	G	19: 11,618,429	L166S	possibly damaging	Het
Mtus2	T	A	5: 148,077,103	Y235*	probably null	Het
Myh4	G	T	11: 67,241,054	W113C	probably damaging	Het
Nav2	T	A	7: 49,548,434	C1270*	probably null	Het
Ncoa5	A	G	2: 165,002,150	L111P	probably damaging	Het
Nup107	T	C	10: 117,770,478	Y453C	probably damaging	Het
Oca2	C	T	7: 56,330,358	Q604*	probably null	Het
Olfr116	A	T	17: 37,623,891	V248D	probably damaging	Het
Olfr1339	A	C	4: 118,734,688	H53P	probably benign	Het
Olfr482	T	A	7: 108,095,096	N158I	probably benign	Het
Olfr525	T	C	7: 140,323,101	M134T	probably benign	Het
Olfr952	T	C	9: 39,426,235	T279A	possibly damaging	Het
Pde3a	G	T	6: 141,470,942	G514V	possibly damaging	Het
Pik3cb	A	T	9: 99,101,328	C76S	probably damaging	Het
Plk1	T	C	7: 122,168,605	V411A	probably damaging	Het
Pole	C	T	5: 110,324,753	P1600L	probably damaging	Het
Prr36	T	C	8: 4,210,881	T979A	probably benign	Het
Rdh7	T	A	10: 127,885,721	T229S	probably benign	Het
Rnpepl1	A	T	1: 92,915,113	T140S	probably damaging	Het
Rps6kc1	A	T	1: 190,798,694	S947T	probably benign	Het
Rtl1	A	G	12: 109,591,704	F1234L	probably damaging	Het
Sdc1	G	A	12: 8,791,708	M279I	probably damaging	Het
Siae	T	C	9: 37,627,800	L169P	possibly damaging	Het
Slc22a22	C	T	15: 57,249,752	V364I	probably benign	Het
Sltm	G	T	9: 70,588,978	V932F	probably damaging	Het
Smad1	A	G	8: 79,349,752	L279P	probably damaging	Het
Spag17	G	T	3: 100,050,831	G935V	probably damaging	Het
Srgap3	A	G	6: 112,746,934	S546P	probably damaging	Het
Stxbp5	T	C	10: 9,809,100	I519V	probably benign	Het
Syt16	A	T	12: 74,129,386	I10F	probably damaging	Het
Trim43b	C	G	9: 89,091,312	G123R	probably damaging	Het
Ubr3	T	C	2: 70,013,131	Y1572H	probably damaging	Het
Umodl1	G	A	17: 31,008,665	R1324H	probably benign	Het
Vmn2r44	A	T	7: 8,377,986	W303R	probably benign	Het
Wdr93	T	C	7: 79,785,774	Y684H	probably damaging	Het
Wnk2	G	A	13: 49,071,002	R268C	probably damaging	Het
Zfp438	C	T	18: 5,213,776	C394Y	possibly damaging	Het

Other mutations in Iqca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Iqca	APN	1	90045657	missense	probably benign	0.10
IGL01367:Iqca	APN	1	90070628	splice site	probably benign
IGL01545:Iqca	APN	1	90045642	missense	probably benign
IGL01797:Iqca	APN	1	90144819	critical splice donor site	probably null
IGL02098:Iqca	APN	1	90047941	missense	probably damaging	0.96
IGL02194:Iqca	APN	1	90045663	missense	probably benign	0.16
IGL03230:Iqca	APN	1	90145002	missense	probably damaging	1.00
IGL03259:Iqca	APN	1	90052434	missense	probably damaging	1.00
IGL03372:Iqca	APN	1	90144969	missense	possibly damaging	0.80
R0383:Iqca	UTSW	1	90142707	missense	probably damaging	1.00
R0610:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0685:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0798:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0799:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0800:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0801:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0825:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0826:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0827:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0862:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0863:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0864:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0960:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0961:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0962:Iqca	UTSW	1	90142731	missense	probably null	0.97
R0963:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1101:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1344:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1523:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1646:Iqca	UTSW	1	90140038	missense	probably damaging	0.98
R1682:Iqca	UTSW	1	90142731	missense	probably null	0.97
R1742:Iqca	UTSW	1	90098051	missense	probably benign	0.01
R1774:Iqca	UTSW	1	90080903	missense	probably benign	0.02
R1775:Iqca	UTSW	1	90081416	missense	probably damaging	1.00
R2011:Iqca	UTSW	1	90045626	missense	probably benign	0.00
R2065:Iqca	UTSW	1	90130231	missense	probably benign	0.01
R2156:Iqca	UTSW	1	90089516	missense	possibly damaging	0.78
R2186:Iqca	UTSW	1	90081344	missense	probably benign	0.06
R3872:Iqca	UTSW	1	90089481	missense	probably damaging	1.00
R4308:Iqca	UTSW	1	90144897	missense	probably damaging	1.00
R4578:Iqca	UTSW	1	90073750	missense	probably damaging	0.98
R4737:Iqca	UTSW	1	90077822	missense	probably damaging	0.99
R4867:Iqca	UTSW	1	90089504	missense	probably benign	0.00
R4884:Iqca	UTSW	1	90140037	missense	probably benign	0.10
R5352:Iqca	UTSW	1	90130196	missense	probably benign	0.00
R5733:Iqca	UTSW	1	90070535	missense	probably damaging	0.97
R5838:Iqca	UTSW	1	90144945	missense	probably benign	0.22
R5951:Iqca	UTSW	1	90140097	splice site	probably null
R5957:Iqca	UTSW	1	90080948	missense	probably damaging	1.00
R6696:Iqca	UTSW	1	90130200	missense	probably benign
R7240:Iqca	UTSW	1	90070550	missense	possibly damaging	0.88
R7769:Iqca	UTSW	1	90077810	missense	possibly damaging	0.82
R7841:Iqca	UTSW	1	90059615	missense
R8069:Iqca	UTSW	1	90045744	missense	probably damaging	0.96
R8103:Iqca	UTSW	1	90059608	missense
R8932:Iqca	UTSW	1	90140028	missense	probably damaging	1.00
R8963:Iqca	UTSW	1	90139927	missense	probably benign	0.02
R9055:Iqca	UTSW	1	90070613	missense	probably benign	0.02
R9168:Iqca	UTSW	1	90138215	missense	probably damaging	0.98
R9342:Iqca	UTSW	1	90144966	missense	probably damaging	0.99
R9647:Iqca	UTSW	1	90070536	missense	probably benign	0.15
Z1176:Iqca	UTSW	1	90045725	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- AGGACTCAAATCCATGGAGGC -3'
(R):5'- TGCCTGGCTCTACAGTAATTTTG -3'

Sequencing Primer
(F):5'- TCCATGGAGGCCAGGAAAATG -3'
(R):5'- GGCTCTACAGTAATTTTGTTCTCTG -3'

Posted On

2016-03-17