Incidental Mutation 'R4887:Cdc42bpa'
ID376940
Institutional Source Beutler Lab
Gene Symbol Cdc42bpa
Ensembl Gene ENSMUSG00000026490
Gene NameCDC42 binding protein kinase alpha
SynonymsA930014J19Rik, DMPK-like
MMRRC Submission 041979-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R4887 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location179960472-180165603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180144635 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1334 (M1334T)
Ref Sequence ENSEMBL: ENSMUSP00000106746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076687] [ENSMUST00000097450] [ENSMUST00000097453] [ENSMUST00000111117] [ENSMUST00000135056] [ENSMUST00000212756]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076687
AA Change: M1240T

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075980
Gene: ENSMUSG00000026490
AA Change: M1240T

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 588 N/A INTRINSIC
coiled coil region 632 735 N/A INTRINSIC
Pfam:DMPK_coil 800 860 2.7e-29 PFAM
C1 919 968 4.09e-7 SMART
PH 989 1109 6.02e-8 SMART
CNH 1134 1411 3.37e-17 SMART
low complexity region 1456 1468 N/A INTRINSIC
PBD 1477 1512 2.05e-10 SMART
low complexity region 1531 1546 N/A INTRINSIC
low complexity region 1567 1580 N/A INTRINSIC
low complexity region 1606 1620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097450
AA Change: M1321T

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095059
Gene: ENSMUSG00000026490
AA Change: M1321T

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.2e-29 PFAM
C1 1000 1049 4.09e-7 SMART
PH 1070 1190 6.02e-8 SMART
CNH 1215 1492 3.37e-17 SMART
low complexity region 1537 1549 N/A INTRINSIC
PBD 1558 1593 2.05e-10 SMART
low complexity region 1612 1627 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
low complexity region 1687 1701 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097453
AA Change: M1293T

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095062
Gene: ENSMUSG00000026490
AA Change: M1293T

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.5e-29 PFAM
C1 972 1021 4.09e-7 SMART
PH 1042 1162 6.02e-8 SMART
CNH 1187 1464 3.37e-17 SMART
low complexity region 1509 1521 N/A INTRINSIC
PBD 1530 1565 2.05e-10 SMART
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1620 1633 N/A INTRINSIC
low complexity region 1659 1673 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111117
AA Change: M1334T

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490
AA Change: M1334T

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
low complexity region 484 499 N/A INTRINSIC
Pfam:KELK 529 608 1.1e-32 PFAM
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.6e-29 PFAM
C1 1013 1062 4.09e-7 SMART
PH 1083 1203 6.02e-8 SMART
CNH 1228 1505 3.37e-17 SMART
low complexity region 1550 1562 N/A INTRINSIC
PBD 1571 1606 2.05e-10 SMART
low complexity region 1625 1640 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
low complexity region 1700 1714 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000133890
AA Change: M649T
SMART Domains Protein: ENSMUSP00000116337
Gene: ENSMUSG00000026490
AA Change: M649T

DomainStartEndE-ValueType
coiled coil region 6 109 N/A INTRINSIC
Pfam:DMPK_coil 175 235 1.4e-29 PFAM
C1 329 378 4.09e-7 SMART
PH 399 519 6.02e-8 SMART
CNH 544 821 3.37e-17 SMART
low complexity region 866 878 N/A INTRINSIC
PBD 887 922 2.05e-10 SMART
low complexity region 941 956 N/A INTRINSIC
low complexity region 977 990 N/A INTRINSIC
low complexity region 1016 1030 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135056
AA Change: M550T

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114333
Gene: ENSMUSG00000026490
AA Change: M550T

DomainStartEndE-ValueType
Pfam:DMPK_coil 59 119 9e-30 PFAM
low complexity region 148 156 N/A INTRINSIC
C1 229 278 4.09e-7 SMART
PH 299 419 6.02e-8 SMART
CNH 444 721 3.37e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000143176
AA Change: M523T
SMART Domains Protein: ENSMUSP00000115261
Gene: ENSMUSG00000026490
AA Change: M523T

DomainStartEndE-ValueType
Pfam:DMPK_coil 84 144 1.3e-29 PFAM
C1 203 252 4.09e-7 SMART
PH 273 393 6.02e-8 SMART
CNH 418 695 3.37e-17 SMART
low complexity region 740 752 N/A INTRINSIC
PBD 761 796 1.02e-5 SMART
PBD 802 839 2.21e-1 SMART
low complexity region 877 892 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 952 966 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195719
Predicted Effect probably benign
Transcript: ENSMUST00000212756
AA Change: M1350T

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Serine/Threonine protein kinase family. This kinase contains multiple functional domains. Its kinase domain is highly similar to that of the myotonic dystrophy protein kinase (DMPK). This kinase also contains a Rac interactive binding (CRIB) domain, and has been shown to bind CDC42. It may function as a CDC42 downstream effector mediating CDC42 induced peripheral actin formation, and promoting cytoskeletal reorganization. Multiple alternatively spliced transcript variants have been described, and the full-length nature of two of them has been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,324 I22F possibly damaging Het
2310009B15Rik A C 1: 138,852,165 Y116* probably null Het
4930548H24Rik A G 5: 31,486,252 I109V probably benign Het
Acer3 T C 7: 98,257,701 T91A possibly damaging Het
Adam12 T C 7: 134,172,821 K20E possibly damaging Het
Adamtsl3 T C 7: 82,574,614 V275A possibly damaging Het
Afg1l C T 10: 42,454,378 V98I probably benign Het
Alpk1 C T 3: 127,673,475 G1052R probably damaging Het
Anln A T 9: 22,380,188 S115T possibly damaging Het
Apob T A 12: 8,013,099 N3827K probably damaging Het
Aqr G A 2: 114,150,509 L264F probably damaging Het
Arhgap33 T C 7: 30,532,192 S123G probably damaging Het
Arvcf C T 16: 18,398,113 R333* probably null Het
Brca2 T A 5: 150,556,937 L2724Q probably damaging Het
Btbd11 C T 10: 85,387,378 T17M unknown Het
C2cd6 T A 1: 59,094,734 T43S probably benign Het
Cacna1h A G 17: 25,377,287 V1920A possibly damaging Het
Capsl A T 15: 9,457,772 I26F possibly damaging Het
Card10 A T 15: 78,781,524 V673E possibly damaging Het
Ccar1 A G 10: 62,753,218 S829P unknown Het
Ceacam2 C T 7: 25,520,832 C267Y probably benign Het
Cep68 G A 11: 20,239,239 T591M probably benign Het
Chil4 T C 3: 106,204,144 K218R probably benign Het
Cldn14 G T 16: 93,919,859 T33K possibly damaging Het
Copa T A 1: 172,092,276 C140S probably benign Het
Coq6 T C 12: 84,372,296 L358P probably damaging Het
Cyfip1 C T 7: 55,872,068 P40L probably damaging Het
Dennd2a A C 6: 39,497,159 S414A probably benign Het
Dpm1 T C 2: 168,217,759 N139S probably benign Het
Dpp7 T A 2: 25,352,758 probably null Het
Ednrb T C 14: 103,820,011 I372V possibly damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Fam135a G A 1: 24,024,253 Q1087* probably null Het
Fancg T C 4: 43,006,866 T275A probably benign Het
Fbn1 T A 2: 125,309,774 H2520L probably damaging Het
Fmn2 T C 1: 174,581,961 S587P unknown Het
Foxr2 A G X: 153,130,316 Q61R probably damaging Het
Frrs1 A G 3: 116,902,416 *124W probably null Het
Gm16432 A G 1: 178,103,949 Y478C unknown Het
Gm7535 T A 17: 17,911,071 probably benign Het
Gm884 T C 11: 103,614,872 H2090R probably benign Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Herc3 T C 6: 58,887,499 V706A probably damaging Het
Hist1h4a T C 13: 23,760,952 D69G probably damaging Het
Hivep3 A G 4: 120,122,934 E1723G probably damaging Het
Igsf9b A G 9: 27,322,650 I382V probably benign Het
Ints1 G T 5: 139,771,156 T467N possibly damaging Het
Iqca G A 1: 90,045,701 T783M probably damaging Het
Kng1 A G 16: 23,067,698 K131R possibly damaging Het
Krt35 T C 11: 100,093,130 Y348C probably damaging Het
Ldlrad3 A G 2: 102,113,536 C64R probably damaging Het
Lilr4b C T 10: 51,484,520 A272V possibly damaging Het
Ltn1 A T 16: 87,398,809 C1276* probably null Het
Matn1 G A 4: 130,952,114 A360T probably benign Het
Minpp1 G A 19: 32,498,384 V306I probably benign Het
Mkx G A 18: 6,992,904 R127W probably damaging Het
Mrpl48 G T 7: 100,546,409 probably benign Het
Ms4a2 A G 19: 11,618,429 L166S possibly damaging Het
Mtus2 T A 5: 148,077,103 Y235* probably null Het
Myh4 G T 11: 67,241,054 W113C probably damaging Het
Nav2 T A 7: 49,548,434 C1270* probably null Het
Ncoa5 A G 2: 165,002,150 L111P probably damaging Het
Nup107 T C 10: 117,770,478 Y453C probably damaging Het
Oca2 C T 7: 56,330,358 Q604* probably null Het
Olfr116 A T 17: 37,623,891 V248D probably damaging Het
Olfr1339 A C 4: 118,734,688 H53P probably benign Het
Olfr482 T A 7: 108,095,096 N158I probably benign Het
Olfr525 T C 7: 140,323,101 M134T probably benign Het
Olfr952 T C 9: 39,426,235 T279A possibly damaging Het
Pde3a G T 6: 141,470,942 G514V possibly damaging Het
Pik3cb A T 9: 99,101,328 C76S probably damaging Het
Plk1 T C 7: 122,168,605 V411A probably damaging Het
Pole C T 5: 110,324,753 P1600L probably damaging Het
Prr36 T C 8: 4,210,881 T979A probably benign Het
Rdh7 T A 10: 127,885,721 T229S probably benign Het
Rnpepl1 A T 1: 92,915,113 T140S probably damaging Het
Rps6kc1 A T 1: 190,798,694 S947T probably benign Het
Rtl1 A G 12: 109,591,704 F1234L probably damaging Het
Sdc1 G A 12: 8,791,708 M279I probably damaging Het
Siae T C 9: 37,627,800 L169P possibly damaging Het
Slc22a22 C T 15: 57,249,752 V364I probably benign Het
Sltm G T 9: 70,588,978 V932F probably damaging Het
Smad1 A G 8: 79,349,752 L279P probably damaging Het
Spag17 G T 3: 100,050,831 G935V probably damaging Het
Srgap3 A G 6: 112,746,934 S546P probably damaging Het
Stxbp5 T C 10: 9,809,100 I519V probably benign Het
Syt16 A T 12: 74,129,386 I10F probably damaging Het
Trim43b C G 9: 89,091,312 G123R probably damaging Het
Ubr3 T C 2: 70,013,131 Y1572H probably damaging Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Vmn2r44 A T 7: 8,377,986 W303R probably benign Het
Wdr93 T C 7: 79,785,774 Y684H probably damaging Het
Wnk2 G A 13: 49,071,002 R268C probably damaging Het
Zfp438 C T 18: 5,213,776 C394Y possibly damaging Het
Other mutations in Cdc42bpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Cdc42bpa APN 1 180106121 missense probably damaging 1.00
IGL00807:Cdc42bpa APN 1 180141453 missense possibly damaging 0.88
IGL00972:Cdc42bpa APN 1 180074684 missense probably benign 0.00
IGL01084:Cdc42bpa APN 1 180142274 splice site probably benign
IGL01149:Cdc42bpa APN 1 180074572 missense probably damaging 0.99
IGL01377:Cdc42bpa APN 1 180065143 missense probably damaging 1.00
IGL01541:Cdc42bpa APN 1 180151158 critical splice acceptor site probably null
IGL01657:Cdc42bpa APN 1 180111866 missense probably benign 0.05
IGL01720:Cdc42bpa APN 1 180111282 missense probably damaging 1.00
IGL02227:Cdc42bpa APN 1 180094424 missense possibly damaging 0.64
IGL02234:Cdc42bpa APN 1 180151191 nonsense probably null
IGL02253:Cdc42bpa APN 1 180031596 splice site probably benign
IGL02587:Cdc42bpa APN 1 180093945 missense possibly damaging 0.91
IGL02671:Cdc42bpa APN 1 180061822 missense probably benign
IGL02746:Cdc42bpa APN 1 180111747 missense possibly damaging 0.91
IGL02756:Cdc42bpa APN 1 180109259 missense possibly damaging 0.77
IGL02994:Cdc42bpa APN 1 179999437 missense probably damaging 1.00
IGL03073:Cdc42bpa APN 1 180094376 splice site probably benign
IGL03295:Cdc42bpa APN 1 180150204 missense probably benign 0.00
P0022:Cdc42bpa UTSW 1 179961276 missense probably damaging 0.99
PIT4142001:Cdc42bpa UTSW 1 180031560 missense probably damaging 1.00
R0125:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
R0268:Cdc42bpa UTSW 1 180155782 intron probably benign
R0472:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0492:Cdc42bpa UTSW 1 180101190 missense probably benign 0.00
R0609:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0691:Cdc42bpa UTSW 1 180144835 missense possibly damaging 0.91
R0738:Cdc42bpa UTSW 1 179999462 splice site probably benign
R1547:Cdc42bpa UTSW 1 180074644 missense probably damaging 0.99
R1553:Cdc42bpa UTSW 1 180093975 missense probably benign 0.01
R1601:Cdc42bpa UTSW 1 180065001 nonsense probably null
R1709:Cdc42bpa UTSW 1 180067224 missense probably damaging 1.00
R2101:Cdc42bpa UTSW 1 180146968 missense probably benign 0.39
R2279:Cdc42bpa UTSW 1 180036919 missense probably damaging 0.99
R2357:Cdc42bpa UTSW 1 180067227 missense possibly damaging 0.81
R2373:Cdc42bpa UTSW 1 180111784 missense possibly damaging 0.78
R2570:Cdc42bpa UTSW 1 180150177 missense possibly damaging 0.84
R3709:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3710:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3816:Cdc42bpa UTSW 1 180144886 missense possibly damaging 0.80
R3854:Cdc42bpa UTSW 1 180155978 intron probably benign
R3855:Cdc42bpa UTSW 1 180155978 intron probably benign
R3917:Cdc42bpa UTSW 1 180106154 critical splice donor site probably null
R4604:Cdc42bpa UTSW 1 180109194 missense probably benign 0.00
R4622:Cdc42bpa UTSW 1 180074658 missense probably damaging 0.98
R4664:Cdc42bpa UTSW 1 180144565 missense probably damaging 0.99
R4665:Cdc42bpa UTSW 1 180144565 missense probably damaging 0.99
R4989:Cdc42bpa UTSW 1 180137801 missense probably damaging 0.99
R5033:Cdc42bpa UTSW 1 180065015 missense probably damaging 1.00
R5050:Cdc42bpa UTSW 1 180072453 nonsense probably null
R5077:Cdc42bpa UTSW 1 180094533 intron probably benign
R5196:Cdc42bpa UTSW 1 180072413 missense probably benign 0.09
R5276:Cdc42bpa UTSW 1 180137850 missense probably damaging 1.00
R5313:Cdc42bpa UTSW 1 180084433 missense probably benign
R5364:Cdc42bpa UTSW 1 180067182 missense probably benign 0.06
R5372:Cdc42bpa UTSW 1 180064979 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180067329 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180138520 missense possibly damaging 0.95
R5646:Cdc42bpa UTSW 1 180106094 missense probably damaging 0.99
R5713:Cdc42bpa UTSW 1 180084410 missense probably benign 0.03
R6012:Cdc42bpa UTSW 1 180065090 missense probably damaging 1.00
R6029:Cdc42bpa UTSW 1 180111787 missense probably damaging 1.00
R6378:Cdc42bpa UTSW 1 180093996 missense possibly damaging 0.91
R6609:Cdc42bpa UTSW 1 180101274 critical splice donor site probably null
R7122:Cdc42bpa UTSW 1 180065018 missense probably damaging 1.00
R7289:Cdc42bpa UTSW 1 180061797 nonsense probably null
R7670:Cdc42bpa UTSW 1 180065081 missense probably damaging 1.00
R7912:Cdc42bpa UTSW 1 180094013 missense probably damaging 1.00
R8139:Cdc42bpa UTSW 1 180069319 missense probably damaging 1.00
R8362:Cdc42bpa UTSW 1 180162125 missense probably damaging 0.98
R8378:Cdc42bpa UTSW 1 180162144 missense probably damaging 0.98
X0026:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
Z1176:Cdc42bpa UTSW 1 180065093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGTCGCTGTGATCTCAG -3'
(R):5'- AGAGAGCGTCCATTGGTTG -3'

Sequencing Primer
(F):5'- TGTGATCTCAGGCCGAAATC -3'
(R):5'- CATTTGAATGGAGCATATTGCATGG -3'
Posted On2016-03-17