Incidental Mutation 'R4887:Aqr'
ID376946
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Nameaquarius
Synonyms
MMRRC Submission 041979-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4887 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location114101170-114187024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114150509 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 264 (L264F)
Ref Sequence ENSEMBL: ENSMUSP00000099602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043160
AA Change: L264F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: L264F

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102543
AA Change: L264F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: L264F

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184524
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,324 I22F possibly damaging Het
2310009B15Rik A C 1: 138,852,165 Y116* probably null Het
4930548H24Rik A G 5: 31,486,252 I109V probably benign Het
Acer3 T C 7: 98,257,701 T91A possibly damaging Het
Adam12 T C 7: 134,172,821 K20E possibly damaging Het
Adamtsl3 T C 7: 82,574,614 V275A possibly damaging Het
Afg1l C T 10: 42,454,378 V98I probably benign Het
Alpk1 C T 3: 127,673,475 G1052R probably damaging Het
Anln A T 9: 22,380,188 S115T possibly damaging Het
Apob T A 12: 8,013,099 N3827K probably damaging Het
Arhgap33 T C 7: 30,532,192 S123G probably damaging Het
Arvcf C T 16: 18,398,113 R333* probably null Het
Brca2 T A 5: 150,556,937 L2724Q probably damaging Het
Btbd11 C T 10: 85,387,378 T17M unknown Het
C2cd6 T A 1: 59,094,734 T43S probably benign Het
Cacna1h A G 17: 25,377,287 V1920A possibly damaging Het
Capsl A T 15: 9,457,772 I26F possibly damaging Het
Card10 A T 15: 78,781,524 V673E possibly damaging Het
Ccar1 A G 10: 62,753,218 S829P unknown Het
Cdc42bpa T C 1: 180,144,635 M1334T possibly damaging Het
Ceacam2 C T 7: 25,520,832 C267Y probably benign Het
Cep68 G A 11: 20,239,239 T591M probably benign Het
Chil4 T C 3: 106,204,144 K218R probably benign Het
Cldn14 G T 16: 93,919,859 T33K possibly damaging Het
Copa T A 1: 172,092,276 C140S probably benign Het
Coq6 T C 12: 84,372,296 L358P probably damaging Het
Cyfip1 C T 7: 55,872,068 P40L probably damaging Het
Dennd2a A C 6: 39,497,159 S414A probably benign Het
Dpm1 T C 2: 168,217,759 N139S probably benign Het
Dpp7 T A 2: 25,352,758 probably null Het
Ednrb T C 14: 103,820,011 I372V possibly damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Fam135a G A 1: 24,024,253 Q1087* probably null Het
Fancg T C 4: 43,006,866 T275A probably benign Het
Fbn1 T A 2: 125,309,774 H2520L probably damaging Het
Fmn2 T C 1: 174,581,961 S587P unknown Het
Foxr2 A G X: 153,130,316 Q61R probably damaging Het
Frrs1 A G 3: 116,902,416 *124W probably null Het
Gm16432 A G 1: 178,103,949 Y478C unknown Het
Gm7535 T A 17: 17,911,071 probably benign Het
Gm884 T C 11: 103,614,872 H2090R probably benign Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Herc3 T C 6: 58,887,499 V706A probably damaging Het
Hist1h4a T C 13: 23,760,952 D69G probably damaging Het
Hivep3 A G 4: 120,122,934 E1723G probably damaging Het
Igsf9b A G 9: 27,322,650 I382V probably benign Het
Ints1 G T 5: 139,771,156 T467N possibly damaging Het
Iqca G A 1: 90,045,701 T783M probably damaging Het
Kng1 A G 16: 23,067,698 K131R possibly damaging Het
Krt35 T C 11: 100,093,130 Y348C probably damaging Het
Ldlrad3 A G 2: 102,113,536 C64R probably damaging Het
Lilr4b C T 10: 51,484,520 A272V possibly damaging Het
Ltn1 A T 16: 87,398,809 C1276* probably null Het
Matn1 G A 4: 130,952,114 A360T probably benign Het
Minpp1 G A 19: 32,498,384 V306I probably benign Het
Mkx G A 18: 6,992,904 R127W probably damaging Het
Mrpl48 G T 7: 100,546,409 probably benign Het
Ms4a2 A G 19: 11,618,429 L166S possibly damaging Het
Mtus2 T A 5: 148,077,103 Y235* probably null Het
Myh4 G T 11: 67,241,054 W113C probably damaging Het
Nav2 T A 7: 49,548,434 C1270* probably null Het
Ncoa5 A G 2: 165,002,150 L111P probably damaging Het
Nup107 T C 10: 117,770,478 Y453C probably damaging Het
Oca2 C T 7: 56,330,358 Q604* probably null Het
Olfr116 A T 17: 37,623,891 V248D probably damaging Het
Olfr1339 A C 4: 118,734,688 H53P probably benign Het
Olfr482 T A 7: 108,095,096 N158I probably benign Het
Olfr525 T C 7: 140,323,101 M134T probably benign Het
Olfr952 T C 9: 39,426,235 T279A possibly damaging Het
Pde3a G T 6: 141,470,942 G514V possibly damaging Het
Pik3cb A T 9: 99,101,328 C76S probably damaging Het
Plk1 T C 7: 122,168,605 V411A probably damaging Het
Pole C T 5: 110,324,753 P1600L probably damaging Het
Prr36 T C 8: 4,210,881 T979A probably benign Het
Rdh7 T A 10: 127,885,721 T229S probably benign Het
Rnpepl1 A T 1: 92,915,113 T140S probably damaging Het
Rps6kc1 A T 1: 190,798,694 S947T probably benign Het
Rtl1 A G 12: 109,591,704 F1234L probably damaging Het
Sdc1 G A 12: 8,791,708 M279I probably damaging Het
Siae T C 9: 37,627,800 L169P possibly damaging Het
Slc22a22 C T 15: 57,249,752 V364I probably benign Het
Sltm G T 9: 70,588,978 V932F probably damaging Het
Smad1 A G 8: 79,349,752 L279P probably damaging Het
Spag17 G T 3: 100,050,831 G935V probably damaging Het
Srgap3 A G 6: 112,746,934 S546P probably damaging Het
Stxbp5 T C 10: 9,809,100 I519V probably benign Het
Syt16 A T 12: 74,129,386 I10F probably damaging Het
Trim43b C G 9: 89,091,312 G123R probably damaging Het
Ubr3 T C 2: 70,013,131 Y1572H probably damaging Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Vmn2r44 A T 7: 8,377,986 W303R probably benign Het
Wdr93 T C 7: 79,785,774 Y684H probably damaging Het
Wnk2 G A 13: 49,071,002 R268C probably damaging Het
Zfp438 C T 18: 5,213,776 C394Y possibly damaging Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 114125942 missense possibly damaging 0.90
IGL00694:Aqr APN 2 114151525 missense probably damaging 1.00
IGL02113:Aqr APN 2 114120027 nonsense probably null
IGL02297:Aqr APN 2 114150481 missense probably benign 0.24
IGL02380:Aqr APN 2 114109936 missense probably damaging 1.00
IGL02410:Aqr APN 2 114136917 missense possibly damaging 0.85
IGL02413:Aqr APN 2 114118780 missense possibly damaging 0.87
IGL02474:Aqr APN 2 114112646 missense probably damaging 1.00
IGL02941:Aqr APN 2 114113354 missense probably damaging 1.00
IGL02981:Aqr APN 2 114134824 splice site probably benign
IGL03001:Aqr APN 2 114146919 missense probably benign
IGL03092:Aqr APN 2 114158943 missense probably benign 0.38
IGL03222:Aqr APN 2 114121256 missense probably damaging 1.00
capricorn UTSW 2 114105882 missense probably damaging 1.00
Goat UTSW 2 114157575 missense probably damaging 1.00
Pliades UTSW 2 114132976 missense probably damaging 1.00
sagittarius UTSW 2 114149016 missense probably damaging 1.00
Zodiac UTSW 2 114108109 missense probably damaging 0.96
PIT4531001:Aqr UTSW 2 114130734 missense possibly damaging 0.94
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0152:Aqr UTSW 2 114159010 missense probably benign 0.07
R0352:Aqr UTSW 2 114170052 missense probably damaging 1.00
R0371:Aqr UTSW 2 114157604 missense possibly damaging 0.80
R0374:Aqr UTSW 2 114130611 missense probably damaging 1.00
R0550:Aqr UTSW 2 114132976 missense probably damaging 1.00
R0604:Aqr UTSW 2 114130604 missense probably benign 0.00
R0685:Aqr UTSW 2 114140977 missense probably damaging 1.00
R1236:Aqr UTSW 2 114116655 missense probably damaging 1.00
R1434:Aqr UTSW 2 114150409 missense probably damaging 1.00
R1806:Aqr UTSW 2 114161652 missense probably damaging 1.00
R2154:Aqr UTSW 2 114137004 missense probably damaging 1.00
R2185:Aqr UTSW 2 114130534 critical splice donor site probably null
R2377:Aqr UTSW 2 114140940 missense possibly damaging 0.58
R2862:Aqr UTSW 2 114136917 missense probably damaging 1.00
R3615:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3616:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3713:Aqr UTSW 2 114118669 splice site probably benign
R3715:Aqr UTSW 2 114118669 splice site probably benign
R4586:Aqr UTSW 2 114112577 missense probably benign 0.06
R4663:Aqr UTSW 2 114161666 nonsense probably null
R4809:Aqr UTSW 2 114175214 utr 5 prime probably benign
R4888:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4952:Aqr UTSW 2 114109937 missense probably damaging 1.00
R4974:Aqr UTSW 2 114113351 missense probably damaging 1.00
R5050:Aqr UTSW 2 114112609 nonsense probably null
R5050:Aqr UTSW 2 114170025 critical splice donor site probably null
R5213:Aqr UTSW 2 114113327 missense probably damaging 1.00
R5263:Aqr UTSW 2 114116578 missense probably damaging 1.00
R5470:Aqr UTSW 2 114157575 missense probably damaging 1.00
R5488:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5489:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5567:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5570:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5641:Aqr UTSW 2 114149034 missense probably damaging 1.00
R5685:Aqr UTSW 2 114156265 missense possibly damaging 0.87
R5963:Aqr UTSW 2 114126961 missense probably damaging 1.00
R5992:Aqr UTSW 2 114143049 nonsense probably null
R6015:Aqr UTSW 2 114175165 start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 114156277 missense possibly damaging 0.93
R6264:Aqr UTSW 2 114109964 missense probably damaging 1.00
R6773:Aqr UTSW 2 114148996 missense possibly damaging 0.64
R6877:Aqr UTSW 2 114116571 nonsense probably null
R7211:Aqr UTSW 2 114134723 missense probably benign 0.01
R7232:Aqr UTSW 2 114105882 missense probably damaging 1.00
R7308:Aqr UTSW 2 114104062 missense possibly damaging 0.86
R7396:Aqr UTSW 2 114119946 nonsense probably null
R7490:Aqr UTSW 2 114158868 critical splice donor site probably null
R7526:Aqr UTSW 2 114108109 missense probably damaging 0.96
R7629:Aqr UTSW 2 114114593 missense probably damaging 1.00
R7828:Aqr UTSW 2 114149016 missense probably damaging 1.00
R8037:Aqr UTSW 2 114161680 missense probably damaging 1.00
R8166:Aqr UTSW 2 114113325 missense possibly damaging 0.95
R8712:Aqr UTSW 2 114118877 missense probably damaging 1.00
R8904:Aqr UTSW 2 114136993 missense probably damaging 0.98
Z1176:Aqr UTSW 2 114108122 missense probably damaging 0.98
Z1176:Aqr UTSW 2 114109991 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GTCCTCCCAGCTATAAGGCTAAG -3'
(R):5'- GAGGCTCTTCTGTGTCATCC -3'

Sequencing Primer
(F):5'- GCAACAACCAACTTAAGAGATTTC -3'
(R):5'- CTTTGTAAAAGGGAAAACATTGCCAC -3'
Posted On2016-03-17