Mutagenetix > Incidental Mutation

Incidental Mutation 'R0295:Spdl1'

37697

Institutional Source

Beutler Lab

Gene Symbol

Spdl1

Ensembl Gene

ENSMUSG00000069910

Gene Name

spindle apparatus coiled-coil protein 1

Synonyms

MMRRC Submission

038512-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.877) question?

Stock #

R0295 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34809190-34833641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34813343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 554 (N554K)

Ref Sequence

ENSEMBL: ENSMUSP00000090882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093191]

AlphaFold

Q923A2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093191
AA Change: N554K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000090882
Gene: ENSMUSG00000069910
AA Change: N554K

Domain	Start	End	E-Value	Type
coiled coil region	35	342	N/A	INTRINSIC
coiled coil region	370	441	N/A	INTRINSIC
low complexity region	463	478	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	A	T	2: 91,282,594	I173N	probably damaging	Het
2610028H24Rik	G	A	10: 76,454,808	S127N	probably damaging	Het
Abcc8	T	C	7: 46,118,054	R953G	probably benign	Het
Adamtsl3	T	A	7: 82,548,005		probably null	Het
Adh4	A	G	3: 138,429,076	D337G	probably damaging	Het
Apob	T	A	12: 8,002,181	Y1207*	probably null	Het
Birc6	T	C	17: 74,613,362		probably benign	Het
Bms1	A	G	6: 118,389,337	I1065T	probably benign	Het
Cacna1i	T	A	15: 80,356,211	L378Q	probably damaging	Het
Ccdc127	C	A	13: 74,356,870	P179H	probably damaging	Het
Ccdc18	A	T	5: 108,173,789	K586N	probably damaging	Het
Cep290	A	C	10: 100,537,821	E1321A	probably damaging	Het
Ctc1	A	G	11: 69,030,588	K682E	possibly damaging	Het
Cux1	A	C	5: 136,313,212	V442G	probably benign	Het
Dph2	A	T	4: 117,890,930	V150E	possibly damaging	Het
Etv6	A	G	6: 134,266,275	D331G	probably benign	Het
Fbxo42	A	G	4: 141,200,497	D696G	probably damaging	Het
Fbxo8	G	A	8: 56,590,074	D198N	probably benign	Het
Gria4	T	C	9: 4,793,840	T73A	possibly damaging	Het
H2afj	C	G	6: 136,808,604	R89G	probably damaging	Het
Ifng	G	T	10: 118,441,249	S32I	possibly damaging	Het
Ildr1	A	G	16: 36,709,477		probably null	Het
Knl1	A	C	2: 119,088,839	D1824A	probably damaging	Het
Lamp3	A	T	16: 19,701,108	Y108*	probably null	Het
Lcp1	A	G	14: 75,199,420	I69V	probably null	Het
Lrp6	A	T	6: 134,457,693	V1349E	probably benign	Het
Lrrcc1	A	T	3: 14,565,849	E1009D	probably benign	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Med14	G	C	X: 12,685,748	R1223G	probably damaging	Het
Mesd	C	T	7: 83,897,865	Q179*	probably null	Het
Myh7	A	G	14: 54,984,821		probably benign	Het
Myo6	T	C	9: 80,283,579	I804T	probably damaging	Het
Neb	T	C	2: 52,284,285	I1521V	possibly damaging	Het
Nosip	T	A	7: 45,076,916	I249N	probably damaging	Het
Nostrin	A	C	2: 69,179,416	E296A	probably benign	Het
Olfr1280	T	A	2: 111,316,154	V225D	probably damaging	Het
Olfr136	A	T	17: 38,335,291	I45F	probably damaging	Het
Olfr491	T	G	7: 108,317,685	S264A	probably benign	Het
Olfr624	T	C	7: 103,670,311	H240R	probably damaging	Het
Oprk1	T	C	1: 5,598,850	L173S	possibly damaging	Het
Pdzd7	A	G	19: 45,037,072	V328A	probably benign	Het
Podxl2	A	T	6: 88,849,678	S215R	probably benign	Het
Prss36	T	G	7: 127,935,855	T418P	possibly damaging	Het
Ralgps2	T	A	1: 156,823,985		probably benign	Het
Rasa2	T	C	9: 96,545,810		probably null	Het
Rgs1	A	T	1: 144,245,486	I149N	probably damaging	Het
Rgs16	A	G	1: 153,743,737	E163G	probably damaging	Het
Rnf121	A	G	7: 102,035,346	F120S	possibly damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slfn8	A	T	11: 83,003,343	Y823*	probably null	Het
St6gal1	T	A	16: 23,356,203		probably benign	Het
Tet3	G	A	6: 83,369,139	P1304S	probably benign	Het
Timm29	T	C	9: 21,593,076		probably null	Het
Tpcn1	T	A	5: 120,539,060	I687F	probably damaging	Het
Trim46	A	G	3: 89,245,113		probably benign	Het
Ttc23	T	A	7: 67,669,852		probably benign	Het
Ttll6	G	T	11: 96,154,714	V586L	probably benign	Het
Ttn	A	T	2: 76,758,611		probably benign	Het
Uba3	A	T	6: 97,191,583	H160Q	possibly damaging	Het
Usp32	A	G	11: 85,053,692	S316P	probably damaging	Het
Vcan	T	C	13: 89,712,191	I352M	probably benign	Het
Zcwpw1	G	T	5: 137,817,472	L412F	probably damaging	Het
Zfp292	A	T	4: 34,806,281	N2254K	probably damaging	Het
Zscan4e	A	G	7: 11,307,616	S138P	probably damaging	Het

Other mutations in Spdl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02417:Spdl1	APN	11	34813354	missense	probably benign	0.27
IGL02694:Spdl1	APN	11	34813621	missense	probably benign	0.05
IGL03131:Spdl1	APN	11	34830765	missense	possibly damaging	0.46
R0319:Spdl1	UTSW	11	34823520	missense	possibly damaging	0.66
R1017:Spdl1	UTSW	11	34819290	missense	possibly damaging	0.66
R1195:Spdl1	UTSW	11	34819817	missense	probably damaging	0.97
R1195:Spdl1	UTSW	11	34819817	missense	probably damaging	0.97
R1195:Spdl1	UTSW	11	34819817	missense	probably damaging	0.97
R1296:Spdl1	UTSW	11	34813607	missense	unknown
R1315:Spdl1	UTSW	11	34813407	missense	unknown
R1799:Spdl1	UTSW	11	34821029	nonsense	probably null
R2002:Spdl1	UTSW	11	34822646	missense	probably benign
R2291:Spdl1	UTSW	11	34819309	nonsense	probably null
R4771:Spdl1	UTSW	11	34813327	missense	probably damaging	0.98
R5030:Spdl1	UTSW	11	34823440	missense	probably benign	0.00
R5167:Spdl1	UTSW	11	34813360	missense	possibly damaging	0.79
R5477:Spdl1	UTSW	11	34822210	missense	possibly damaging	0.66
R6258:Spdl1	UTSW	11	34819886	missense	probably damaging	0.97
R6260:Spdl1	UTSW	11	34819886	missense	probably damaging	0.97
R6554:Spdl1	UTSW	11	34822570	missense	possibly damaging	0.82
R6695:Spdl1	UTSW	11	34823003	splice site	probably null
R6714:Spdl1	UTSW	11	34823003	splice site	probably null
R6980:Spdl1	UTSW	11	34830879	start codon destroyed	probably null	0.04
R7355:Spdl1	UTSW	11	34823364	missense	not run
R7791:Spdl1	UTSW	11	34813477	missense	possibly damaging	0.83
R7844:Spdl1	UTSW	11	34813343	missense	possibly damaging	0.82
R8029:Spdl1	UTSW	11	34822592	missense	probably benign	0.00
R8515:Spdl1	UTSW	11	34813425	missense	possibly damaging	0.92
R8923:Spdl1	UTSW	11	34813651	missense	possibly damaging	0.66
R9005:Spdl1	UTSW	11	34809708	missense	possibly damaging	0.83
R9502:Spdl1	UTSW	11	34822456	missense	possibly damaging	0.66
Z1176:Spdl1	UTSW	11	34822457	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GGAAGGCCACCCAGACTGTAGA -3'
(R):5'- GCAGTGGAAACAGCCAGCCTC -3'

Sequencing Primer
(F):5'- TCAGACTGCAGAGCTCTAGT -3'
(R):5'- AGCCTCTTCATGTGTGCAG -3'

Posted On

2013-05-23