Mutagenetix > Incidental Mutation

Incidental Mutation 'R4887:Smad1'

376983

Institutional Source

Beutler Lab

Gene Symbol

Smad1

Ensembl Gene

ENSMUSG00000031681

Gene Name

SMAD family member 1

Synonyms

Madh1, Smad 1, Madr1

MMRRC Submission

041979-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4887 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79338395-79399518 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79349752 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 279 (L279P)

Ref Sequence

ENSEMBL: ENSMUSP00000071035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066091] [ENSMUST00000109885]

AlphaFold

P70340

PDB Structure

Crystal Structure of SMAD1-MH1/DNA complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000066091
AA Change: L279P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000071035
Gene: ENSMUSG00000031681
AA Change: L279P

Domain	Start	End	E-Value	Type
DWA	25	134	6.94e-68	SMART
low complexity region	179	212	N/A	INTRINSIC
low complexity region	219	233	N/A	INTRINSIC
DWB	269	441	2.73e-107	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109885
AA Change: L279P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105511
Gene: ENSMUSG00000031681
AA Change: L279P

Domain	Start	End	E-Value	Type
DWA	25	134	6.94e-68	SMART
low complexity region	179	212	N/A	INTRINSIC
low complexity region	219	233	N/A	INTRINSIC
DWB	269	425	3.92e-76	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210678

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215983

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signals of the bone morphogenetic proteins (BMPs), which are involved in a range of biological activities including cell growth, apoptosis, morphogenesis, development and immune responses. In response to BMP ligands, this protein can be phosphorylated and activated by the BMP receptor kinase. The phosphorylated form of this protein forms a complex with SMAD4, which is important for its function in the transcription regulation. This protein is a target for SMAD-specific E3 ubiquitin ligases, such as SMURF1 and SMURF2, and undergoes ubiquitination and proteasome-mediated degradation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired allantois formation resulting in the lack of a placenta, and die around embryonic day 9-10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,876,324	I22F	possibly damaging	Het
2310009B15Rik	A	C	1: 138,852,165	Y116*	probably null	Het
4930548H24Rik	A	G	5: 31,486,252	I109V	probably benign	Het
Acer3	T	C	7: 98,257,701	T91A	possibly damaging	Het
Adam12	T	C	7: 134,172,821	K20E	possibly damaging	Het
Adamtsl3	T	C	7: 82,574,614	V275A	possibly damaging	Het
Afg1l	C	T	10: 42,454,378	V98I	probably benign	Het
Alpk1	C	T	3: 127,673,475	G1052R	probably damaging	Het
Anln	A	T	9: 22,380,188	S115T	possibly damaging	Het
Apob	T	A	12: 8,013,099	N3827K	probably damaging	Het
Aqr	G	A	2: 114,150,509	L264F	probably damaging	Het
Arhgap33	T	C	7: 30,532,192	S123G	probably damaging	Het
Arvcf	C	T	16: 18,398,113	R333*	probably null	Het
Brca2	T	A	5: 150,556,937	L2724Q	probably damaging	Het
Btbd11	C	T	10: 85,387,378	T17M	unknown	Het
C2cd6	T	A	1: 59,094,734	T43S	probably benign	Het
Cacna1h	A	G	17: 25,377,287	V1920A	possibly damaging	Het
Capsl	A	T	15: 9,457,772	I26F	possibly damaging	Het
Card10	A	T	15: 78,781,524	V673E	possibly damaging	Het
Ccar1	A	G	10: 62,753,218	S829P	unknown	Het
Cdc42bpa	T	C	1: 180,144,635	M1334T	possibly damaging	Het
Ceacam2	C	T	7: 25,520,832	C267Y	probably benign	Het
Cep68	G	A	11: 20,239,239	T591M	probably benign	Het
Chil4	T	C	3: 106,204,144	K218R	probably benign	Het
Cldn14	G	T	16: 93,919,859	T33K	possibly damaging	Het
Copa	T	A	1: 172,092,276	C140S	probably benign	Het
Coq6	T	C	12: 84,372,296	L358P	probably damaging	Het
Cyfip1	C	T	7: 55,872,068	P40L	probably damaging	Het
Dennd2a	A	C	6: 39,497,159	S414A	probably benign	Het
Dpm1	T	C	2: 168,217,759	N139S	probably benign	Het
Dpp7	T	A	2: 25,352,758		probably null	Het
Ednrb	T	C	14: 103,820,011	I372V	possibly damaging	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Fam135a	G	A	1: 24,024,253	Q1087*	probably null	Het
Fancg	T	C	4: 43,006,866	T275A	probably benign	Het
Fbn1	T	A	2: 125,309,774	H2520L	probably damaging	Het
Fmn2	T	C	1: 174,581,961	S587P	unknown	Het
Foxr2	A	G	X: 153,130,316	Q61R	probably damaging	Het
Frrs1	A	G	3: 116,902,416	*124W	probably null	Het
Gm16432	A	G	1: 178,103,949	Y478C	unknown	Het
Gm7535	T	A	17: 17,911,071		probably benign	Het
Gm884	T	C	11: 103,614,872	H2090R	probably benign	Het
Gm996	G	A	2: 25,579,747	R51C	possibly damaging	Het
Herc3	T	C	6: 58,887,499	V706A	probably damaging	Het
Hist1h4a	T	C	13: 23,760,952	D69G	probably damaging	Het
Hivep3	A	G	4: 120,122,934	E1723G	probably damaging	Het
Igsf9b	A	G	9: 27,322,650	I382V	probably benign	Het
Ints1	G	T	5: 139,771,156	T467N	possibly damaging	Het
Iqca	G	A	1: 90,045,701	T783M	probably damaging	Het
Kng1	A	G	16: 23,067,698	K131R	possibly damaging	Het
Krt35	T	C	11: 100,093,130	Y348C	probably damaging	Het
Ldlrad3	A	G	2: 102,113,536	C64R	probably damaging	Het
Lilr4b	C	T	10: 51,484,520	A272V	possibly damaging	Het
Ltn1	A	T	16: 87,398,809	C1276*	probably null	Het
Matn1	G	A	4: 130,952,114	A360T	probably benign	Het
Minpp1	G	A	19: 32,498,384	V306I	probably benign	Het
Mkx	G	A	18: 6,992,904	R127W	probably damaging	Het
Mrpl48	G	T	7: 100,546,409		probably benign	Het
Ms4a2	A	G	19: 11,618,429	L166S	possibly damaging	Het
Mtus2	T	A	5: 148,077,103	Y235*	probably null	Het
Myh4	G	T	11: 67,241,054	W113C	probably damaging	Het
Nav2	T	A	7: 49,548,434	C1270*	probably null	Het
Ncoa5	A	G	2: 165,002,150	L111P	probably damaging	Het
Nup107	T	C	10: 117,770,478	Y453C	probably damaging	Het
Oca2	C	T	7: 56,330,358	Q604*	probably null	Het
Olfr116	A	T	17: 37,623,891	V248D	probably damaging	Het
Olfr1339	A	C	4: 118,734,688	H53P	probably benign	Het
Olfr482	T	A	7: 108,095,096	N158I	probably benign	Het
Olfr525	T	C	7: 140,323,101	M134T	probably benign	Het
Olfr952	T	C	9: 39,426,235	T279A	possibly damaging	Het
Pde3a	G	T	6: 141,470,942	G514V	possibly damaging	Het
Pik3cb	A	T	9: 99,101,328	C76S	probably damaging	Het
Plk1	T	C	7: 122,168,605	V411A	probably damaging	Het
Pole	C	T	5: 110,324,753	P1600L	probably damaging	Het
Prr36	T	C	8: 4,210,881	T979A	probably benign	Het
Rdh7	T	A	10: 127,885,721	T229S	probably benign	Het
Rnpepl1	A	T	1: 92,915,113	T140S	probably damaging	Het
Rps6kc1	A	T	1: 190,798,694	S947T	probably benign	Het
Rtl1	A	G	12: 109,591,704	F1234L	probably damaging	Het
Sdc1	G	A	12: 8,791,708	M279I	probably damaging	Het
Siae	T	C	9: 37,627,800	L169P	possibly damaging	Het
Slc22a22	C	T	15: 57,249,752	V364I	probably benign	Het
Sltm	G	T	9: 70,588,978	V932F	probably damaging	Het
Spag17	G	T	3: 100,050,831	G935V	probably damaging	Het
Srgap3	A	G	6: 112,746,934	S546P	probably damaging	Het
Stxbp5	T	C	10: 9,809,100	I519V	probably benign	Het
Syt16	A	T	12: 74,129,386	I10F	probably damaging	Het
Trim43b	C	G	9: 89,091,312	G123R	probably damaging	Het
Ubr3	T	C	2: 70,013,131	Y1572H	probably damaging	Het
Umodl1	G	A	17: 31,008,665	R1324H	probably benign	Het
Vmn2r44	A	T	7: 8,377,986	W303R	probably benign	Het
Wdr93	T	C	7: 79,785,774	Y684H	probably damaging	Het
Wnk2	G	A	13: 49,071,002	R268C	probably damaging	Het
Zfp438	C	T	18: 5,213,776	C394Y	possibly damaging	Het

Other mutations in Smad1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Smad1	APN	8	79356469	missense	probably damaging	0.97
IGL01792:Smad1	APN	8	79372123	missense	probably damaging	1.00
R0395:Smad1	UTSW	8	79349782	missense	probably benign	0.01
R0400:Smad1	UTSW	8	79371770	splice site	probably benign
R0990:Smad1	UTSW	8	79343788	missense	probably damaging	1.00
R1371:Smad1	UTSW	8	79349578	splice site	probably benign
R1481:Smad1	UTSW	8	79343730	missense	probably benign	0.20
R1661:Smad1	UTSW	8	79372029	missense	probably damaging	1.00
R1665:Smad1	UTSW	8	79372029	missense	probably damaging	1.00
R1797:Smad1	UTSW	8	79343844	missense	probably damaging	1.00
R2879:Smad1	UTSW	8	79353455	splice site	probably null
R3624:Smad1	UTSW	8	79339698	missense	probably benign	0.31
R3791:Smad1	UTSW	8	79339770	missense	probably damaging	1.00
R3815:Smad1	UTSW	8	79343730	missense	probably benign	0.20
R3819:Smad1	UTSW	8	79343730	missense	probably benign	0.20
R5438:Smad1	UTSW	8	79356320	missense	probably benign	0.19
R8836:Smad1	UTSW	8	79371925	missense	probably damaging	1.00
R9308:Smad1	UTSW	8	79372270	start gained	probably benign
X0064:Smad1	UTSW	8	79353404	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACAGGAATGACTGAGTCACTTCTAG -3'
(R):5'- TGTAGTCGCCCTTGCATGTC -3'

Sequencing Primer
(F):5'- ACTGAGTCACTTCTAGAGGAATAAG -3'
(R):5'- CTTCTCTGTGTGGTGCCCAG -3'

Posted On

2016-03-17