Mutagenetix > Incidental Mutation

Incidental Mutation 'R4887:Igsf9b'

376985

Institutional Source

Beutler Lab

Gene Symbol

Igsf9b

Ensembl Gene

ENSMUSG00000034275

Gene Name

immunoglobulin superfamily, member 9B

Synonyms

LOC235086

MMRRC Submission

041979-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.466) question?

Stock #

R4887 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27299204-27357546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27322650 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 382 (I382V)

Ref Sequence

ENSEMBL: ENSMUSP00000117017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]

AlphaFold

E9PZ19

Predicted Effect

probably benign
Transcript: ENSMUST00000115247
AA Change: I382V

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: I382V

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133213
AA Change: I382V

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: I382V

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART
transmembrane domain	727	749	N/A	INTRINSIC
low complexity region	750	760	N/A	INTRINSIC
low complexity region	835	843	N/A	INTRINSIC
low complexity region	971	982	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1148	1161	N/A	INTRINSIC
low complexity region	1172	1190	N/A	INTRINSIC
low complexity region	1246	1273	N/A	INTRINSIC
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1313	1326	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214187

Predicted Effect

probably benign
Transcript: ENSMUST00000214357
AA Change: I382V

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,876,324	I22F	possibly damaging	Het
2310009B15Rik	A	C	1: 138,852,165	Y116*	probably null	Het
4930548H24Rik	A	G	5: 31,486,252	I109V	probably benign	Het
Acer3	T	C	7: 98,257,701	T91A	possibly damaging	Het
Adam12	T	C	7: 134,172,821	K20E	possibly damaging	Het
Adamtsl3	T	C	7: 82,574,614	V275A	possibly damaging	Het
Afg1l	C	T	10: 42,454,378	V98I	probably benign	Het
Alpk1	C	T	3: 127,673,475	G1052R	probably damaging	Het
Anln	A	T	9: 22,380,188	S115T	possibly damaging	Het
Apob	T	A	12: 8,013,099	N3827K	probably damaging	Het
Aqr	G	A	2: 114,150,509	L264F	probably damaging	Het
Arhgap33	T	C	7: 30,532,192	S123G	probably damaging	Het
Arvcf	C	T	16: 18,398,113	R333*	probably null	Het
Brca2	T	A	5: 150,556,937	L2724Q	probably damaging	Het
Btbd11	C	T	10: 85,387,378	T17M	unknown	Het
C2cd6	T	A	1: 59,094,734	T43S	probably benign	Het
Cacna1h	A	G	17: 25,377,287	V1920A	possibly damaging	Het
Capsl	A	T	15: 9,457,772	I26F	possibly damaging	Het
Card10	A	T	15: 78,781,524	V673E	possibly damaging	Het
Ccar1	A	G	10: 62,753,218	S829P	unknown	Het
Cdc42bpa	T	C	1: 180,144,635	M1334T	possibly damaging	Het
Ceacam2	C	T	7: 25,520,832	C267Y	probably benign	Het
Cep68	G	A	11: 20,239,239	T591M	probably benign	Het
Chil4	T	C	3: 106,204,144	K218R	probably benign	Het
Cldn14	G	T	16: 93,919,859	T33K	possibly damaging	Het
Copa	T	A	1: 172,092,276	C140S	probably benign	Het
Coq6	T	C	12: 84,372,296	L358P	probably damaging	Het
Cyfip1	C	T	7: 55,872,068	P40L	probably damaging	Het
Dennd2a	A	C	6: 39,497,159	S414A	probably benign	Het
Dpm1	T	C	2: 168,217,759	N139S	probably benign	Het
Dpp7	T	A	2: 25,352,758		probably null	Het
Ednrb	T	C	14: 103,820,011	I372V	possibly damaging	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Fam135a	G	A	1: 24,024,253	Q1087*	probably null	Het
Fancg	T	C	4: 43,006,866	T275A	probably benign	Het
Fbn1	T	A	2: 125,309,774	H2520L	probably damaging	Het
Fmn2	T	C	1: 174,581,961	S587P	unknown	Het
Foxr2	A	G	X: 153,130,316	Q61R	probably damaging	Het
Frrs1	A	G	3: 116,902,416	*124W	probably null	Het
Gm16432	A	G	1: 178,103,949	Y478C	unknown	Het
Gm7535	T	A	17: 17,911,071		probably benign	Het
Gm884	T	C	11: 103,614,872	H2090R	probably benign	Het
Gm996	G	A	2: 25,579,747	R51C	possibly damaging	Het
Herc3	T	C	6: 58,887,499	V706A	probably damaging	Het
Hist1h4a	T	C	13: 23,760,952	D69G	probably damaging	Het
Hivep3	A	G	4: 120,122,934	E1723G	probably damaging	Het
Ints1	G	T	5: 139,771,156	T467N	possibly damaging	Het
Iqca	G	A	1: 90,045,701	T783M	probably damaging	Het
Kng1	A	G	16: 23,067,698	K131R	possibly damaging	Het
Krt35	T	C	11: 100,093,130	Y348C	probably damaging	Het
Ldlrad3	A	G	2: 102,113,536	C64R	probably damaging	Het
Lilr4b	C	T	10: 51,484,520	A272V	possibly damaging	Het
Ltn1	A	T	16: 87,398,809	C1276*	probably null	Het
Matn1	G	A	4: 130,952,114	A360T	probably benign	Het
Minpp1	G	A	19: 32,498,384	V306I	probably benign	Het
Mkx	G	A	18: 6,992,904	R127W	probably damaging	Het
Mrpl48	G	T	7: 100,546,409		probably benign	Het
Ms4a2	A	G	19: 11,618,429	L166S	possibly damaging	Het
Mtus2	T	A	5: 148,077,103	Y235*	probably null	Het
Myh4	G	T	11: 67,241,054	W113C	probably damaging	Het
Nav2	T	A	7: 49,548,434	C1270*	probably null	Het
Ncoa5	A	G	2: 165,002,150	L111P	probably damaging	Het
Nup107	T	C	10: 117,770,478	Y453C	probably damaging	Het
Oca2	C	T	7: 56,330,358	Q604*	probably null	Het
Olfr116	A	T	17: 37,623,891	V248D	probably damaging	Het
Olfr1339	A	C	4: 118,734,688	H53P	probably benign	Het
Olfr482	T	A	7: 108,095,096	N158I	probably benign	Het
Olfr525	T	C	7: 140,323,101	M134T	probably benign	Het
Olfr952	T	C	9: 39,426,235	T279A	possibly damaging	Het
Pde3a	G	T	6: 141,470,942	G514V	possibly damaging	Het
Pik3cb	A	T	9: 99,101,328	C76S	probably damaging	Het
Plk1	T	C	7: 122,168,605	V411A	probably damaging	Het
Pole	C	T	5: 110,324,753	P1600L	probably damaging	Het
Prr36	T	C	8: 4,210,881	T979A	probably benign	Het
Rdh7	T	A	10: 127,885,721	T229S	probably benign	Het
Rnpepl1	A	T	1: 92,915,113	T140S	probably damaging	Het
Rps6kc1	A	T	1: 190,798,694	S947T	probably benign	Het
Rtl1	A	G	12: 109,591,704	F1234L	probably damaging	Het
Sdc1	G	A	12: 8,791,708	M279I	probably damaging	Het
Siae	T	C	9: 37,627,800	L169P	possibly damaging	Het
Slc22a22	C	T	15: 57,249,752	V364I	probably benign	Het
Sltm	G	T	9: 70,588,978	V932F	probably damaging	Het
Smad1	A	G	8: 79,349,752	L279P	probably damaging	Het
Spag17	G	T	3: 100,050,831	G935V	probably damaging	Het
Srgap3	A	G	6: 112,746,934	S546P	probably damaging	Het
Stxbp5	T	C	10: 9,809,100	I519V	probably benign	Het
Syt16	A	T	12: 74,129,386	I10F	probably damaging	Het
Trim43b	C	G	9: 89,091,312	G123R	probably damaging	Het
Ubr3	T	C	2: 70,013,131	Y1572H	probably damaging	Het
Umodl1	G	A	17: 31,008,665	R1324H	probably benign	Het
Vmn2r44	A	T	7: 8,377,986	W303R	probably benign	Het
Wdr93	T	C	7: 79,785,774	Y684H	probably damaging	Het
Wnk2	G	A	13: 49,071,002	R268C	probably damaging	Het
Zfp438	C	T	18: 5,213,776	C394Y	possibly damaging	Het

Other mutations in Igsf9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Igsf9b	APN	9	27319655	missense	probably damaging	1.00
IGL01013:Igsf9b	APN	9	27334304	missense	probably damaging	1.00
IGL01960:Igsf9b	APN	9	27328606	missense	possibly damaging	0.93
IGL02398:Igsf9b	APN	9	27333130	missense	possibly damaging	0.54
IGL03007:Igsf9b	APN	9	27333082	missense	probably damaging	0.98
G1Funyon:Igsf9b	UTSW	9	27334739	utr 3 prime	probably benign
IGL03014:Igsf9b	UTSW	9	27322636	missense	probably benign	0.00
R0127:Igsf9b	UTSW	9	27334385	missense	possibly damaging	0.65
R0376:Igsf9b	UTSW	9	27334582	missense	probably benign	0.01
R0520:Igsf9b	UTSW	9	27323250	missense	probably benign	0.00
R0534:Igsf9b	UTSW	9	27333062	splice site	probably null
R0613:Igsf9b	UTSW	9	27326920	missense	probably damaging	1.00
R0718:Igsf9b	UTSW	9	27323361	critical splice donor site	probably null
R0828:Igsf9b	UTSW	9	27319605	nonsense	probably null
R0879:Igsf9b	UTSW	9	27333742	missense	probably damaging	1.00
R0882:Igsf9b	UTSW	9	27319316	missense	probably damaging	0.98
R0987:Igsf9b	UTSW	9	27332553	splice site	probably null
R1162:Igsf9b	UTSW	9	27326889	missense	probably benign
R1758:Igsf9b	UTSW	9	27334252	missense	possibly damaging	0.50
R1760:Igsf9b	UTSW	9	27317827	missense	possibly damaging	0.82
R1819:Igsf9b	UTSW	9	27311593	missense	probably damaging	0.98
R1823:Igsf9b	UTSW	9	27331732	missense	probably damaging	0.96
R1982:Igsf9b	UTSW	9	27322239	missense	possibly damaging	0.82
R2150:Igsf9b	UTSW	9	27334337	missense	probably damaging	1.00
R2228:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2229:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2250:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R3415:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3416:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3417:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3427:Igsf9b	UTSW	9	27334577	missense	probably damaging	0.99
R4356:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4357:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4358:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4359:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4379:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4416:Igsf9b	UTSW	9	27322917	missense	probably damaging	1.00
R4445:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4446:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4787:Igsf9b	UTSW	9	27317456	missense	probably benign	0.26
R5085:Igsf9b	UTSW	9	27317437	missense	probably benign	0.03
R5360:Igsf9b	UTSW	9	27311672	missense	probably damaging	0.98
R5417:Igsf9b	UTSW	9	27334276	small insertion	probably benign
R5686:Igsf9b	UTSW	9	27324179	missense	probably damaging	0.99
R5738:Igsf9b	UTSW	9	27328530	missense	probably damaging	0.98
R5869:Igsf9b	UTSW	9	27323235	missense	probably benign	0.44
R6304:Igsf9b	UTSW	9	27342575	missense	probably benign	0.19
R6359:Igsf9b	UTSW	9	27309599	missense	probably benign	0.25
R6367:Igsf9b	UTSW	9	27309525	nonsense	probably null
R6556:Igsf9b	UTSW	9	27329555	missense	probably damaging	1.00
R7058:Igsf9b	UTSW	9	27322854	missense	probably damaging	0.99
R7165:Igsf9b	UTSW	9	27334240	missense	probably benign
R7180:Igsf9b	UTSW	9	27322668	missense	possibly damaging	0.95
R7212:Igsf9b	UTSW	9	27331696	missense	probably damaging	0.98
R7461:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R7605:Igsf9b	UTSW	9	27323312	missense	probably damaging	0.98
R7609:Igsf9b	UTSW	9	27345890	missense	probably benign
R7613:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R8072:Igsf9b	UTSW	9	27317364	missense	possibly damaging	0.94
R8163:Igsf9b	UTSW	9	27322611	splice site	probably null
R8301:Igsf9b	UTSW	9	27334739	utr 3 prime	probably benign
R8546:Igsf9b	UTSW	9	27333130	missense	possibly damaging	0.54
R8553:Igsf9b	UTSW	9	27333443	missense	probably damaging	0.96
R9438:Igsf9b	UTSW	9	27332543	missense	probably benign	0.03
R9585:Igsf9b	UTSW	9	27322236	missense	probably damaging	1.00
R9720:Igsf9b	UTSW	9	27309514	missense	probably damaging	0.99
X0013:Igsf9b	UTSW	9	27331725	missense	possibly damaging	0.89
X0025:Igsf9b	UTSW	9	27309461	missense	probably damaging	1.00
X0028:Igsf9b	UTSW	9	27334372	missense	probably damaging	1.00
Z1176:Igsf9b	UTSW	9	27317353	critical splice acceptor site	probably null
Z1177:Igsf9b	UTSW	9	27334292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAACGATCTGGCAGGAGTTTG -3'
(R):5'- TCCTAATGGAAGCACAGAGAC -3'

Sequencing Primer
(F):5'- TGTGCTCCATGCCCACTGG -3'
(R):5'- ACAGGTATAAAAGGTTGGCCAC -3'

Posted On

2016-03-17