Incidental Mutation 'R0295:Slfn8'
ID 37699
Institutional Source Beutler Lab
Gene Symbol Slfn8
Ensembl Gene ENSMUSG00000035208
Gene Name schlafen 8
Synonyms
MMRRC Submission 038512-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R0295 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 82892984-82911636 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 82894169 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 823 (Y823*)
Ref Sequence ENSEMBL: ENSMUSP00000090513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]
AlphaFold B1ARD8
Predicted Effect probably null
Transcript: ENSMUST00000038141
AA Change: Y823*
SMART Domains Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: Y823*

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 1.6e-18 PFAM
Pfam:DUF2075 592 766 5.8e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092838
AA Change: Y823*
SMART Domains Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: Y823*

DomainStartEndE-ValueType
Pfam:AlbA_2 205 341 1.4e-17 PFAM
Pfam:DUF2075 592 767 2.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108152
SMART Domains Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 4.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130822
SMART Domains Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 3.7e-19 PFAM
SCOP:d1ly1a_ 593 625 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131883
SMART Domains Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AlbA_2 27 163 1.8e-15 PFAM
SCOP:d1ly1a_ 370 402 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215239
Meta Mutation Damage Score 0.9643 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik G A 10: 76,290,642 (GRCm39) S127N probably damaging Het
Abcc8 T C 7: 45,767,478 (GRCm39) R953G probably benign Het
Adamtsl3 T A 7: 82,197,213 (GRCm39) probably null Het
Adh4 A G 3: 138,134,837 (GRCm39) D337G probably damaging Het
Apob T A 12: 8,052,181 (GRCm39) Y1207* probably null Het
Birc6 T C 17: 74,920,357 (GRCm39) probably benign Het
Bms1 A G 6: 118,366,298 (GRCm39) I1065T probably benign Het
Cacna1i T A 15: 80,240,412 (GRCm39) L378Q probably damaging Het
Ccdc127 C A 13: 74,504,989 (GRCm39) P179H probably damaging Het
Ccdc18 A T 5: 108,321,655 (GRCm39) K586N probably damaging Het
Cep290 A C 10: 100,373,683 (GRCm39) E1321A probably damaging Het
Cstpp1 A T 2: 91,112,939 (GRCm39) I173N probably damaging Het
Ctc1 A G 11: 68,921,414 (GRCm39) K682E possibly damaging Het
Cux1 A C 5: 136,342,066 (GRCm39) V442G probably benign Het
Dph2 A T 4: 117,748,127 (GRCm39) V150E possibly damaging Het
Etv6 A G 6: 134,243,238 (GRCm39) D331G probably benign Het
Fbxo42 A G 4: 140,927,808 (GRCm39) D696G probably damaging Het
Fbxo8 G A 8: 57,043,109 (GRCm39) D198N probably benign Het
Gria4 T C 9: 4,793,840 (GRCm39) T73A possibly damaging Het
H2aj C G 6: 136,785,602 (GRCm39) R89G probably damaging Het
Ifng G T 10: 118,277,154 (GRCm39) S32I possibly damaging Het
Ildr1 A G 16: 36,529,839 (GRCm39) probably null Het
Knl1 A C 2: 118,919,320 (GRCm39) D1824A probably damaging Het
Lamp3 A T 16: 19,519,858 (GRCm39) Y108* probably null Het
Lcp1 A G 14: 75,436,860 (GRCm39) I69V probably null Het
Lrp6 A T 6: 134,434,656 (GRCm39) V1349E probably benign Het
Lrrcc1 A T 3: 14,630,909 (GRCm39) E1009D probably benign Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Med14 G C X: 12,551,987 (GRCm39) R1223G probably damaging Het
Mesd C T 7: 83,547,073 (GRCm39) Q179* probably null Het
Myh7 A G 14: 55,222,278 (GRCm39) probably benign Het
Myo6 T C 9: 80,190,861 (GRCm39) I804T probably damaging Het
Neb T C 2: 52,174,297 (GRCm39) I1521V possibly damaging Het
Nosip T A 7: 44,726,340 (GRCm39) I249N probably damaging Het
Nostrin A C 2: 69,009,760 (GRCm39) E296A probably benign Het
Oprk1 T C 1: 5,669,073 (GRCm39) L173S possibly damaging Het
Or2n1d A T 17: 38,646,182 (GRCm39) I45F probably damaging Het
Or4k36 T A 2: 111,146,499 (GRCm39) V225D probably damaging Het
Or51v8 T C 7: 103,319,518 (GRCm39) H240R probably damaging Het
Or5p1 T G 7: 107,916,892 (GRCm39) S264A probably benign Het
Pdzd7 A G 19: 45,025,511 (GRCm39) V328A probably benign Het
Podxl2 A T 6: 88,826,660 (GRCm39) S215R probably benign Het
Prss36 T G 7: 127,535,027 (GRCm39) T418P possibly damaging Het
Ralgps2 T A 1: 156,651,555 (GRCm39) probably benign Het
Rasa2 T C 9: 96,427,863 (GRCm39) probably null Het
Rgs1 A T 1: 144,121,224 (GRCm39) I149N probably damaging Het
Rgs16 A G 1: 153,619,483 (GRCm39) E163G probably damaging Het
Rnf121 A G 7: 101,684,553 (GRCm39) F120S possibly damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Spdl1 A T 11: 34,704,170 (GRCm39) N554K possibly damaging Het
St6gal1 T A 16: 23,174,953 (GRCm39) probably benign Het
Tet3 G A 6: 83,346,121 (GRCm39) P1304S probably benign Het
Timm29 T C 9: 21,504,372 (GRCm39) probably null Het
Tpcn1 T A 5: 120,677,125 (GRCm39) I687F probably damaging Het
Trim46 A G 3: 89,152,420 (GRCm39) probably benign Het
Ttc23 T A 7: 67,319,600 (GRCm39) probably benign Het
Ttll6 G T 11: 96,045,540 (GRCm39) V586L probably benign Het
Ttn A T 2: 76,588,955 (GRCm39) probably benign Het
Uba3 A T 6: 97,168,544 (GRCm39) H160Q possibly damaging Het
Usp32 A G 11: 84,944,518 (GRCm39) S316P probably damaging Het
Vcan T C 13: 89,860,310 (GRCm39) I352M probably benign Het
Zcwpw1 G T 5: 137,815,734 (GRCm39) L412F probably damaging Het
Zfp292 A T 4: 34,806,281 (GRCm39) N2254K probably damaging Het
Zscan4e A G 7: 11,041,543 (GRCm39) S138P probably damaging Het
Other mutations in Slfn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Slfn8 APN 11 82,904,310 (GRCm39) missense possibly damaging 0.75
IGL01418:Slfn8 APN 11 82,895,462 (GRCm39) missense probably damaging 1.00
IGL01620:Slfn8 APN 11 82,895,059 (GRCm39) nonsense probably null
IGL01875:Slfn8 APN 11 82,894,905 (GRCm39) missense probably benign 0.30
IGL01896:Slfn8 APN 11 82,894,522 (GRCm39) missense probably damaging 1.00
IGL01929:Slfn8 APN 11 82,894,231 (GRCm39) nonsense probably null
IGL02111:Slfn8 APN 11 82,895,324 (GRCm39) missense probably damaging 1.00
IGL02136:Slfn8 APN 11 82,894,291 (GRCm39) nonsense probably null
IGL02165:Slfn8 APN 11 82,908,022 (GRCm39) missense probably benign 0.00
IGL02645:Slfn8 APN 11 82,894,380 (GRCm39) missense possibly damaging 0.82
IGL02682:Slfn8 APN 11 82,894,517 (GRCm39) missense probably damaging 1.00
IGL02689:Slfn8 APN 11 82,907,934 (GRCm39) missense probably damaging 1.00
IGL02948:Slfn8 APN 11 82,894,078 (GRCm39) missense probably damaging 0.99
IGL03037:Slfn8 APN 11 82,894,078 (GRCm39) missense probably damaging 0.99
IGL03185:Slfn8 APN 11 82,908,333 (GRCm39) missense probably benign 0.01
IGL03243:Slfn8 APN 11 82,894,533 (GRCm39) missense probably damaging 1.00
IGL03286:Slfn8 APN 11 82,904,294 (GRCm39) missense probably damaging 0.99
seven_dwarfs UTSW 11 82,894,160 (GRCm39) missense probably benign 0.09
vanwinkle UTSW 11 82,908,219 (GRCm39) missense probably damaging 1.00
R0368:Slfn8 UTSW 11 82,907,958 (GRCm39) missense probably damaging 1.00
R0382:Slfn8 UTSW 11 82,895,382 (GRCm39) missense probably damaging 1.00
R0655:Slfn8 UTSW 11 82,894,647 (GRCm39) missense probably benign 0.35
R0894:Slfn8 UTSW 11 82,894,407 (GRCm39) missense probably benign 0.07
R1006:Slfn8 UTSW 11 82,894,337 (GRCm39) missense possibly damaging 0.69
R1181:Slfn8 UTSW 11 82,907,571 (GRCm39) missense probably benign 0.19
R1187:Slfn8 UTSW 11 82,894,314 (GRCm39) missense probably damaging 1.00
R1501:Slfn8 UTSW 11 82,894,006 (GRCm39) missense probably damaging 0.99
R1646:Slfn8 UTSW 11 82,907,712 (GRCm39) missense probably damaging 1.00
R1909:Slfn8 UTSW 11 82,894,447 (GRCm39) nonsense probably null
R2005:Slfn8 UTSW 11 82,894,976 (GRCm39) missense probably damaging 1.00
R2363:Slfn8 UTSW 11 82,894,920 (GRCm39) missense probably damaging 1.00
R3780:Slfn8 UTSW 11 82,908,280 (GRCm39) missense probably benign 0.13
R3890:Slfn8 UTSW 11 82,895,270 (GRCm39) missense possibly damaging 0.68
R3917:Slfn8 UTSW 11 82,907,819 (GRCm39) nonsense probably null
R4559:Slfn8 UTSW 11 82,895,570 (GRCm39) missense probably damaging 1.00
R4684:Slfn8 UTSW 11 82,908,332 (GRCm39) missense probably benign 0.10
R4767:Slfn8 UTSW 11 82,894,023 (GRCm39) missense possibly damaging 0.66
R4773:Slfn8 UTSW 11 82,908,219 (GRCm39) missense probably damaging 1.00
R4859:Slfn8 UTSW 11 82,908,540 (GRCm39) start codon destroyed probably null 0.99
R4916:Slfn8 UTSW 11 82,907,704 (GRCm39) missense probably damaging 1.00
R4939:Slfn8 UTSW 11 82,894,111 (GRCm39) missense probably benign 0.01
R5107:Slfn8 UTSW 11 82,907,976 (GRCm39) missense probably damaging 0.99
R5130:Slfn8 UTSW 11 82,894,647 (GRCm39) missense probably benign 0.35
R5165:Slfn8 UTSW 11 82,907,953 (GRCm39) missense probably damaging 0.99
R5238:Slfn8 UTSW 11 82,904,214 (GRCm39) missense probably damaging 0.96
R5282:Slfn8 UTSW 11 82,908,550 (GRCm39) critical splice acceptor site probably null
R5311:Slfn8 UTSW 11 82,894,910 (GRCm39) missense probably damaging 1.00
R5499:Slfn8 UTSW 11 82,895,042 (GRCm39) missense probably damaging 0.99
R5617:Slfn8 UTSW 11 82,895,547 (GRCm39) missense probably benign 0.01
R5782:Slfn8 UTSW 11 82,907,867 (GRCm39) missense probably damaging 0.98
R5823:Slfn8 UTSW 11 82,907,562 (GRCm39) missense probably benign 0.01
R5886:Slfn8 UTSW 11 82,894,160 (GRCm39) missense probably benign 0.09
R5933:Slfn8 UTSW 11 82,894,161 (GRCm39) missense probably benign 0.00
R6151:Slfn8 UTSW 11 82,908,147 (GRCm39) missense probably damaging 1.00
R6163:Slfn8 UTSW 11 82,894,690 (GRCm39) makesense probably null
R6191:Slfn8 UTSW 11 82,907,626 (GRCm39) missense possibly damaging 0.72
R6419:Slfn8 UTSW 11 82,894,881 (GRCm39) splice site probably null
R6925:Slfn8 UTSW 11 82,904,243 (GRCm39) nonsense probably null
R7065:Slfn8 UTSW 11 82,907,794 (GRCm39) missense probably benign 0.01
R7380:Slfn8 UTSW 11 82,894,566 (GRCm39) missense not run
R7414:Slfn8 UTSW 11 82,907,618 (GRCm39) nonsense probably null
R7819:Slfn8 UTSW 11 82,895,081 (GRCm39) missense probably damaging 1.00
R8425:Slfn8 UTSW 11 82,895,441 (GRCm39) missense possibly damaging 0.80
R8517:Slfn8 UTSW 11 82,894,968 (GRCm39) missense possibly damaging 0.68
R8804:Slfn8 UTSW 11 82,907,639 (GRCm39) missense possibly damaging 0.94
R8814:Slfn8 UTSW 11 82,907,505 (GRCm39) missense possibly damaging 0.95
R9069:Slfn8 UTSW 11 82,907,902 (GRCm39) missense probably damaging 1.00
R9233:Slfn8 UTSW 11 82,894,422 (GRCm39) missense probably damaging 1.00
R9457:Slfn8 UTSW 11 82,908,532 (GRCm39) missense probably benign
R9678:Slfn8 UTSW 11 82,907,723 (GRCm39) missense probably damaging 1.00
R9708:Slfn8 UTSW 11 82,894,267 (GRCm39) missense probably benign 0.00
R9764:Slfn8 UTSW 11 82,907,838 (GRCm39) missense probably damaging 1.00
X0021:Slfn8 UTSW 11 82,907,754 (GRCm39) missense possibly damaging 0.69
Z1177:Slfn8 UTSW 11 82,894,359 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TTGAGCTATGCCCCTCAGGAGTTG -3'
(R):5'- TCACGCCAGTATCCAAGGGAAGAG -3'

Sequencing Primer
(F):5'- ATGTTTCATTGCTCTGGAAGCC -3'
(R):5'- GCTGAGTTCCTACAAAAAGAGTTGC -3'
Posted On 2013-05-23