Mutagenetix > Incidental Mutation

Incidental Mutation 'R4887:Pik3cb'

376990

Institutional Source

Beutler Lab

Gene Symbol

Pik3cb

Ensembl Gene

ENSMUSG00000032462

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta

Synonyms

p110beta, 1110001J02Rik

MMRRC Submission

041979-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R4887 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99036654-99140621 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 99101328 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 76 (C76S)

Ref Sequence

ENSEMBL: ENSMUSP00000035037 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035037] [ENSMUST00000124723] [ENSMUST00000136965]

AlphaFold

Q8BTI9

PDB Structure

CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Discovery and Optimization of Pyrimidone Indoline Amide PI3Kbeta Inhibitors for the Treatment of Phosphatase and TENsin homologue (PTEN)-Deficient Cancers [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035037
AA Change: C76S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000035037
Gene: ENSMUSG00000032462
AA Change: C76S

Domain	Start	End	E-Value	Type
PI3K_p85B	35	112	2.44e-50	SMART
PI3K_rbd	174	282	1.88e-42	SMART
low complexity region	305	311	N/A	INTRINSIC
PI3K_C2	315	417	4.64e-33	SMART
PI3Ka	519	705	1.08e-92	SMART
PI3Kc	795	1061	8.75e-134	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124723

SMART Domains

Protein: ENSMUSP00000121466
Gene: ENSMUSG00000032462

Domain	Start	End	E-Value	Type
Pfam:PI3K_p85B	35	68	3.6e-14	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136965
AA Change: C76S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000138346
Gene: ENSMUSG00000032462
AA Change: C76S

Domain	Start	End	E-Value	Type
PI3K_p85B	35	112	2.44e-50	SMART
PI3K_rbd	174	282	1.88e-42	SMART
low complexity region	305	311	N/A	INTRINSIC
PI3K_C2	315	417	4.64e-33	SMART
Blast:PI3Ka	450	520	1e-37	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit 30% fetal lethality, decreased size at birth and postnatally, abnormal glucose homeostasis, and dyslipidemia. Mice homozygous for a different knock-out allele die prior to E8.5 [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	T	17: 56,876,324	I22F	possibly damaging	Het
2310009B15Rik	A	C	1: 138,852,165	Y116*	probably null	Het
4930548H24Rik	A	G	5: 31,486,252	I109V	probably benign	Het
Acer3	T	C	7: 98,257,701	T91A	possibly damaging	Het
Adam12	T	C	7: 134,172,821	K20E	possibly damaging	Het
Adamtsl3	T	C	7: 82,574,614	V275A	possibly damaging	Het
Afg1l	C	T	10: 42,454,378	V98I	probably benign	Het
Alpk1	C	T	3: 127,673,475	G1052R	probably damaging	Het
Anln	A	T	9: 22,380,188	S115T	possibly damaging	Het
Apob	T	A	12: 8,013,099	N3827K	probably damaging	Het
Aqr	G	A	2: 114,150,509	L264F	probably damaging	Het
Arhgap33	T	C	7: 30,532,192	S123G	probably damaging	Het
Arvcf	C	T	16: 18,398,113	R333*	probably null	Het
Brca2	T	A	5: 150,556,937	L2724Q	probably damaging	Het
Btbd11	C	T	10: 85,387,378	T17M	unknown	Het
C2cd6	T	A	1: 59,094,734	T43S	probably benign	Het
Cacna1h	A	G	17: 25,377,287	V1920A	possibly damaging	Het
Capsl	A	T	15: 9,457,772	I26F	possibly damaging	Het
Card10	A	T	15: 78,781,524	V673E	possibly damaging	Het
Ccar1	A	G	10: 62,753,218	S829P	unknown	Het
Cdc42bpa	T	C	1: 180,144,635	M1334T	possibly damaging	Het
Ceacam2	C	T	7: 25,520,832	C267Y	probably benign	Het
Cep68	G	A	11: 20,239,239	T591M	probably benign	Het
Chil4	T	C	3: 106,204,144	K218R	probably benign	Het
Cldn14	G	T	16: 93,919,859	T33K	possibly damaging	Het
Copa	T	A	1: 172,092,276	C140S	probably benign	Het
Coq6	T	C	12: 84,372,296	L358P	probably damaging	Het
Cyfip1	C	T	7: 55,872,068	P40L	probably damaging	Het
Dennd2a	A	C	6: 39,497,159	S414A	probably benign	Het
Dpm1	T	C	2: 168,217,759	N139S	probably benign	Het
Dpp7	T	A	2: 25,352,758		probably null	Het
Ednrb	T	C	14: 103,820,011	I372V	possibly damaging	Het
Edrf1	G	T	7: 133,658,610	M83I	probably damaging	Het
Fam135a	G	A	1: 24,024,253	Q1087*	probably null	Het
Fancg	T	C	4: 43,006,866	T275A	probably benign	Het
Fbn1	T	A	2: 125,309,774	H2520L	probably damaging	Het
Fmn2	T	C	1: 174,581,961	S587P	unknown	Het
Foxr2	A	G	X: 153,130,316	Q61R	probably damaging	Het
Frrs1	A	G	3: 116,902,416	*124W	probably null	Het
Gm16432	A	G	1: 178,103,949	Y478C	unknown	Het
Gm7535	T	A	17: 17,911,071		probably benign	Het
Gm884	T	C	11: 103,614,872	H2090R	probably benign	Het
Gm996	G	A	2: 25,579,747	R51C	possibly damaging	Het
Herc3	T	C	6: 58,887,499	V706A	probably damaging	Het
Hist1h4a	T	C	13: 23,760,952	D69G	probably damaging	Het
Hivep3	A	G	4: 120,122,934	E1723G	probably damaging	Het
Igsf9b	A	G	9: 27,322,650	I382V	probably benign	Het
Ints1	G	T	5: 139,771,156	T467N	possibly damaging	Het
Iqca	G	A	1: 90,045,701	T783M	probably damaging	Het
Kng1	A	G	16: 23,067,698	K131R	possibly damaging	Het
Krt35	T	C	11: 100,093,130	Y348C	probably damaging	Het
Ldlrad3	A	G	2: 102,113,536	C64R	probably damaging	Het
Lilr4b	C	T	10: 51,484,520	A272V	possibly damaging	Het
Ltn1	A	T	16: 87,398,809	C1276*	probably null	Het
Matn1	G	A	4: 130,952,114	A360T	probably benign	Het
Minpp1	G	A	19: 32,498,384	V306I	probably benign	Het
Mkx	G	A	18: 6,992,904	R127W	probably damaging	Het
Mrpl48	G	T	7: 100,546,409		probably benign	Het
Ms4a2	A	G	19: 11,618,429	L166S	possibly damaging	Het
Mtus2	T	A	5: 148,077,103	Y235*	probably null	Het
Myh4	G	T	11: 67,241,054	W113C	probably damaging	Het
Nav2	T	A	7: 49,548,434	C1270*	probably null	Het
Ncoa5	A	G	2: 165,002,150	L111P	probably damaging	Het
Nup107	T	C	10: 117,770,478	Y453C	probably damaging	Het
Oca2	C	T	7: 56,330,358	Q604*	probably null	Het
Olfr116	A	T	17: 37,623,891	V248D	probably damaging	Het
Olfr1339	A	C	4: 118,734,688	H53P	probably benign	Het
Olfr482	T	A	7: 108,095,096	N158I	probably benign	Het
Olfr525	T	C	7: 140,323,101	M134T	probably benign	Het
Olfr952	T	C	9: 39,426,235	T279A	possibly damaging	Het
Pde3a	G	T	6: 141,470,942	G514V	possibly damaging	Het
Plk1	T	C	7: 122,168,605	V411A	probably damaging	Het
Pole	C	T	5: 110,324,753	P1600L	probably damaging	Het
Prr36	T	C	8: 4,210,881	T979A	probably benign	Het
Rdh7	T	A	10: 127,885,721	T229S	probably benign	Het
Rnpepl1	A	T	1: 92,915,113	T140S	probably damaging	Het
Rps6kc1	A	T	1: 190,798,694	S947T	probably benign	Het
Rtl1	A	G	12: 109,591,704	F1234L	probably damaging	Het
Sdc1	G	A	12: 8,791,708	M279I	probably damaging	Het
Siae	T	C	9: 37,627,800	L169P	possibly damaging	Het
Slc22a22	C	T	15: 57,249,752	V364I	probably benign	Het
Sltm	G	T	9: 70,588,978	V932F	probably damaging	Het
Smad1	A	G	8: 79,349,752	L279P	probably damaging	Het
Spag17	G	T	3: 100,050,831	G935V	probably damaging	Het
Srgap3	A	G	6: 112,746,934	S546P	probably damaging	Het
Stxbp5	T	C	10: 9,809,100	I519V	probably benign	Het
Syt16	A	T	12: 74,129,386	I10F	probably damaging	Het
Trim43b	C	G	9: 89,091,312	G123R	probably damaging	Het
Ubr3	T	C	2: 70,013,131	Y1572H	probably damaging	Het
Umodl1	G	A	17: 31,008,665	R1324H	probably benign	Het
Vmn2r44	A	T	7: 8,377,986	W303R	probably benign	Het
Wdr93	T	C	7: 79,785,774	Y684H	probably damaging	Het
Wnk2	G	A	13: 49,071,002	R268C	probably damaging	Het
Zfp438	C	T	18: 5,213,776	C394Y	possibly damaging	Het

Other mutations in Pik3cb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Pik3cb	APN	9	99101286	missense	probably damaging	0.96
IGL01354:Pik3cb	APN	9	99064168	missense	possibly damaging	0.83
IGL02132:Pik3cb	APN	9	99071377	missense	probably benign	0.01
IGL02268:Pik3cb	APN	9	99046556	missense	probably benign	0.00
IGL02376:Pik3cb	APN	9	99052352	missense	probably benign	0.00
IGL02378:Pik3cb	APN	9	99062840	missense	probably benign	0.40
IGL02748:Pik3cb	APN	9	99062968	splice site	probably benign
IGL03038:Pik3cb	APN	9	99065597	missense	probably damaging	1.00
IGL03142:Pik3cb	APN	9	99065562	missense	probably benign	0.10
H8786:Pik3cb	UTSW	9	99046559	missense	possibly damaging	0.80
R0071:Pik3cb	UTSW	9	99044865	missense	probably benign	0.02
R0071:Pik3cb	UTSW	9	99044865	missense	probably benign	0.02
R0305:Pik3cb	UTSW	9	99064076	missense	possibly damaging	0.86
R0464:Pik3cb	UTSW	9	99044743	critical splice donor site	probably null
R0635:Pik3cb	UTSW	9	99064218	splice site	probably benign
R1386:Pik3cb	UTSW	9	99064027	missense	possibly damaging	0.90
R1530:Pik3cb	UTSW	9	99053973	missense	probably damaging	0.96
R1802:Pik3cb	UTSW	9	99101289	nonsense	probably null
R1815:Pik3cb	UTSW	9	99093095	missense	possibly damaging	0.93
R2011:Pik3cb	UTSW	9	99105579	nonsense	probably null
R2079:Pik3cb	UTSW	9	99060204	missense	probably benign	0.27
R2153:Pik3cb	UTSW	9	99101244	nonsense	probably null
R2237:Pik3cb	UTSW	9	99041028	missense	probably damaging	1.00
R2238:Pik3cb	UTSW	9	99041028	missense	probably damaging	1.00
R2513:Pik3cb	UTSW	9	99061842	missense	probably damaging	1.00
R3982:Pik3cb	UTSW	9	99046601	missense	probably benign	0.06
R4009:Pik3cb	UTSW	9	99040929	missense	probably damaging	0.98
R4246:Pik3cb	UTSW	9	99101176	splice site	probably null
R4248:Pik3cb	UTSW	9	99101176	splice site	probably null
R4249:Pik3cb	UTSW	9	99101176	splice site	probably null
R4334:Pik3cb	UTSW	9	99061851	missense	probably damaging	1.00
R4544:Pik3cb	UTSW	9	99039759	missense	probably damaging	1.00
R4568:Pik3cb	UTSW	9	99090302	missense	probably benign	0.00
R4571:Pik3cb	UTSW	9	99090257	missense	possibly damaging	0.94
R4595:Pik3cb	UTSW	9	99055406	missense	possibly damaging	0.95
R4599:Pik3cb	UTSW	9	99061764	missense	probably benign	0.15
R4820:Pik3cb	UTSW	9	99073626	missense	probably benign	0.00
R4967:Pik3cb	UTSW	9	99105632	missense	probably benign	0.14
R5029:Pik3cb	UTSW	9	99054060	missense	probably damaging	0.98
R5031:Pik3cb	UTSW	9	99071408	missense	probably damaging	1.00
R5394:Pik3cb	UTSW	9	99088663	missense	probably benign
R5769:Pik3cb	UTSW	9	99093159	nonsense	probably null
R6128:Pik3cb	UTSW	9	99064099	missense	possibly damaging	0.95
R6250:Pik3cb	UTSW	9	99094598	missense	probably benign	0.01
R6354:Pik3cb	UTSW	9	99073643	missense	probably benign	0.00
R6370:Pik3cb	UTSW	9	99040934	missense	probably damaging	1.00
R6664:Pik3cb	UTSW	9	99094538	missense	possibly damaging	0.56
R6665:Pik3cb	UTSW	9	99073649	missense	probably benign	0.00
R6751:Pik3cb	UTSW	9	99094521	missense	probably benign
R6781:Pik3cb	UTSW	9	99040992	missense	possibly damaging	0.52
R6869:Pik3cb	UTSW	9	99060259	missense	probably benign	0.08
R6883:Pik3cb	UTSW	9	99101400	missense	probably benign	0.00
R7150:Pik3cb	UTSW	9	99093090	missense	probably damaging	1.00
R7446:Pik3cb	UTSW	9	99046658	missense	probably damaging	1.00
R7679:Pik3cb	UTSW	9	99088607	missense	probably benign	0.05
R7831:Pik3cb	UTSW	9	99088613	missense	probably benign
R8300:Pik3cb	UTSW	9	99046658	missense	probably damaging	1.00
R8837:Pik3cb	UTSW	9	99054064	missense	possibly damaging	0.65
R8911:Pik3cb	UTSW	9	99064148	missense	probably benign	0.40
R9299:Pik3cb	UTSW	9	99061791	missense	probably damaging	1.00
R9337:Pik3cb	UTSW	9	99061791	missense	probably damaging	1.00
R9477:Pik3cb	UTSW	9	99040920	critical splice donor site	probably null
R9641:Pik3cb	UTSW	9	99073736	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCGGAGACACTTGCATGC -3'
(R):5'- TGTCTAACCGCACGAGTTG -3'

Sequencing Primer
(F):5'- GCTAGCATTGCATACTGGAAAC -3'
(R):5'- ACGAGTTGTGACTGGCAG -3'

Posted On

2016-03-17