Incidental Mutation 'R4887:Afg1l'
ID 376992
Institutional Source Beutler Lab
Gene Symbol Afg1l
Ensembl Gene ENSMUSG00000038302
Gene Name AFG1 like ATPase
Synonyms Lace1
MMRRC Submission 041979-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R4887 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 42188581-42354561 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 42330374 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 98 (V98I)
Ref Sequence ENSEMBL: ENSMUSP00000036149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041024] [ENSMUST00000133326]
AlphaFold Q3V384
Predicted Effect probably benign
Transcript: ENSMUST00000041024
AA Change: V98I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000036149
Gene: ENSMUSG00000038302
AA Change: V98I

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 74 432 4.4e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133326
AA Change: V98I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123510
Gene: ENSMUSG00000038302
AA Change: V98I

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 73 272 2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151747
SMART Domains Protein: ENSMUSP00000120389
Gene: ENSMUSG00000038302

DomainStartEndE-ValueType
Pfam:AFG1_ATPase 5 300 2e-97 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial integral membrane protein that plays a role in mitochondrial protein homeostasis. The protein contains a P-loop motif and a five-domain structure that is conserved in fly, yeast, and bacteria. It functions to mediate the degradation of nuclear-encoded complex IV subunits. Two conserved estrogen receptor binding sites are located within 2.5 kb of this gene. Polymorphisms in this gene have been associated with bipolar disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A C 1: 138,779,903 (GRCm39) Y116* probably null Het
Abtb3 C T 10: 85,223,242 (GRCm39) T17M unknown Het
Acer3 T C 7: 97,906,908 (GRCm39) T91A possibly damaging Het
Acsbg3 A T 17: 57,183,324 (GRCm39) I22F possibly damaging Het
Adam12 T C 7: 133,774,550 (GRCm39) K20E possibly damaging Het
Adamtsl3 T C 7: 82,223,822 (GRCm39) V275A possibly damaging Het
Ajm1 G A 2: 25,469,759 (GRCm39) R51C possibly damaging Het
Alpk1 C T 3: 127,467,124 (GRCm39) G1052R probably damaging Het
Anln A T 9: 22,291,484 (GRCm39) S115T possibly damaging Het
Apob T A 12: 8,063,099 (GRCm39) N3827K probably damaging Het
Aqr G A 2: 113,980,990 (GRCm39) L264F probably damaging Het
Arhgap33 T C 7: 30,231,617 (GRCm39) S123G probably damaging Het
Arvcf C T 16: 18,216,863 (GRCm39) R333* probably null Het
Brca2 T A 5: 150,480,402 (GRCm39) L2724Q probably damaging Het
C2cd6 T A 1: 59,133,893 (GRCm39) T43S probably benign Het
Cacna1h A G 17: 25,596,261 (GRCm39) V1920A possibly damaging Het
Capsl A T 15: 9,457,858 (GRCm39) I26F possibly damaging Het
Card10 A T 15: 78,665,724 (GRCm39) V673E possibly damaging Het
Catspere2 A G 1: 177,931,515 (GRCm39) Y478C unknown Het
Ccar1 A G 10: 62,588,997 (GRCm39) S829P unknown Het
Ccdc121 A G 5: 31,643,596 (GRCm39) I109V probably benign Het
Cdc42bpa T C 1: 179,972,200 (GRCm39) M1334T possibly damaging Het
Ceacam2 C T 7: 25,220,257 (GRCm39) C267Y probably benign Het
Cep68 G A 11: 20,189,239 (GRCm39) T591M probably benign Het
Chil4 T C 3: 106,111,460 (GRCm39) K218R probably benign Het
Cldn14 G T 16: 93,716,747 (GRCm39) T33K possibly damaging Het
Copa T A 1: 171,919,843 (GRCm39) C140S probably benign Het
Coq6 T C 12: 84,419,070 (GRCm39) L358P probably damaging Het
Cyfip1 C T 7: 55,521,816 (GRCm39) P40L probably damaging Het
Dennd2a A C 6: 39,474,093 (GRCm39) S414A probably benign Het
Dpm1 T C 2: 168,059,679 (GRCm39) N139S probably benign Het
Dpp7 T A 2: 25,242,770 (GRCm39) probably null Het
Ednrb T C 14: 104,057,447 (GRCm39) I372V possibly damaging Het
Edrf1 G T 7: 133,260,339 (GRCm39) M83I probably damaging Het
Fam135a G A 1: 24,063,334 (GRCm39) Q1087* probably null Het
Fancg T C 4: 43,006,866 (GRCm39) T275A probably benign Het
Fbn1 T A 2: 125,151,694 (GRCm39) H2520L probably damaging Het
Fmn2 T C 1: 174,409,527 (GRCm39) S587P unknown Het
Foxr2 A G X: 151,913,312 (GRCm39) Q61R probably damaging Het
Frrs1 A G 3: 116,696,065 (GRCm39) *124W probably null Het
Gm7535 T A 17: 18,131,333 (GRCm39) probably benign Het
H4c1 T C 13: 23,944,935 (GRCm39) D69G probably damaging Het
Herc3 T C 6: 58,864,484 (GRCm39) V706A probably damaging Het
Hivep3 A G 4: 119,980,131 (GRCm39) E1723G probably damaging Het
Igsf9b A G 9: 27,233,946 (GRCm39) I382V probably benign Het
Ints1 G T 5: 139,756,911 (GRCm39) T467N possibly damaging Het
Iqca1 G A 1: 89,973,423 (GRCm39) T783M probably damaging Het
Kng1 A G 16: 22,886,448 (GRCm39) K131R possibly damaging Het
Krt35 T C 11: 99,983,956 (GRCm39) Y348C probably damaging Het
Ldlrad3 A G 2: 101,943,881 (GRCm39) C64R probably damaging Het
Lilrb4b C T 10: 51,360,616 (GRCm39) A272V possibly damaging Het
Lrrc37 T C 11: 103,505,698 (GRCm39) H2090R probably benign Het
Ltn1 A T 16: 87,195,697 (GRCm39) C1276* probably null Het
Matn1 G A 4: 130,679,425 (GRCm39) A360T probably benign Het
Minpp1 G A 19: 32,475,784 (GRCm39) V306I probably benign Het
Mkx G A 18: 6,992,904 (GRCm39) R127W probably damaging Het
Mrpl48 G T 7: 100,195,616 (GRCm39) probably benign Het
Ms4a2 A G 19: 11,595,793 (GRCm39) L166S possibly damaging Het
Mtus2 T A 5: 148,013,913 (GRCm39) Y235* probably null Het
Myh4 G T 11: 67,131,880 (GRCm39) W113C probably damaging Het
Nav2 T A 7: 49,198,182 (GRCm39) C1270* probably null Het
Ncoa5 A G 2: 164,844,070 (GRCm39) L111P probably damaging Het
Nup107 T C 10: 117,606,383 (GRCm39) Y453C probably damaging Het
Oca2 C T 7: 55,980,106 (GRCm39) Q604* probably null Het
Or13a19 T C 7: 139,903,014 (GRCm39) M134T probably benign Het
Or13p5 A C 4: 118,591,885 (GRCm39) H53P probably benign Het
Or14j10 A T 17: 37,934,782 (GRCm39) V248D probably damaging Het
Or5p58 T A 7: 107,694,303 (GRCm39) N158I probably benign Het
Or8g33 T C 9: 39,337,531 (GRCm39) T279A possibly damaging Het
Pde3a G T 6: 141,416,668 (GRCm39) G514V possibly damaging Het
Pik3cb A T 9: 98,983,381 (GRCm39) C76S probably damaging Het
Plk1 T C 7: 121,767,828 (GRCm39) V411A probably damaging Het
Pole C T 5: 110,472,619 (GRCm39) P1600L probably damaging Het
Prr36 T C 8: 4,260,881 (GRCm39) T979A probably benign Het
Rdh7 T A 10: 127,721,590 (GRCm39) T229S probably benign Het
Rnpepl1 A T 1: 92,842,835 (GRCm39) T140S probably damaging Het
Rps6kc1 A T 1: 190,530,891 (GRCm39) S947T probably benign Het
Rtl1 A G 12: 109,558,138 (GRCm39) F1234L probably damaging Het
Sdc1 G A 12: 8,841,708 (GRCm39) M279I probably damaging Het
Siae T C 9: 37,539,096 (GRCm39) L169P possibly damaging Het
Slc22a22 C T 15: 57,113,148 (GRCm39) V364I probably benign Het
Sltm G T 9: 70,496,260 (GRCm39) V932F probably damaging Het
Smad1 A G 8: 80,076,381 (GRCm39) L279P probably damaging Het
Spag17 G T 3: 99,958,147 (GRCm39) G935V probably damaging Het
Srgap3 A G 6: 112,723,895 (GRCm39) S546P probably damaging Het
Stxbp5 T C 10: 9,684,844 (GRCm39) I519V probably benign Het
Syt16 A T 12: 74,176,160 (GRCm39) I10F probably damaging Het
Trim43b C G 9: 88,973,365 (GRCm39) G123R probably damaging Het
Ubr3 T C 2: 69,843,475 (GRCm39) Y1572H probably damaging Het
Umodl1 G A 17: 31,227,639 (GRCm39) R1324H probably benign Het
Vmn2r44 A T 7: 8,380,985 (GRCm39) W303R probably benign Het
Wdr93 T C 7: 79,435,522 (GRCm39) Y684H probably damaging Het
Wnk2 G A 13: 49,224,478 (GRCm39) R268C probably damaging Het
Zfp438 C T 18: 5,213,776 (GRCm39) C394Y possibly damaging Het
Other mutations in Afg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Afg1l APN 10 42,215,907 (GRCm39) missense possibly damaging 0.86
IGL02041:Afg1l APN 10 42,330,376 (GRCm39) missense probably damaging 0.98
IGL02309:Afg1l APN 10 42,330,374 (GRCm39) missense possibly damaging 0.90
IGL02323:Afg1l APN 10 42,330,506 (GRCm39) nonsense probably null
IGL03088:Afg1l APN 10 42,302,493 (GRCm39) missense probably damaging 1.00
PIT4458001:Afg1l UTSW 10 42,330,366 (GRCm39) nonsense probably null
R0969:Afg1l UTSW 10 42,194,617 (GRCm39) missense probably damaging 1.00
R1665:Afg1l UTSW 10 42,302,573 (GRCm39) missense probably damaging 1.00
R1703:Afg1l UTSW 10 42,276,395 (GRCm39) missense probably damaging 1.00
R1766:Afg1l UTSW 10 42,330,491 (GRCm39) missense probably benign 0.00
R2941:Afg1l UTSW 10 42,354,291 (GRCm39) splice site probably null
R4846:Afg1l UTSW 10 42,330,490 (GRCm39) missense probably benign 0.02
R5668:Afg1l UTSW 10 42,236,236 (GRCm39) missense probably damaging 1.00
R5934:Afg1l UTSW 10 42,194,682 (GRCm39) missense probably damaging 1.00
R6575:Afg1l UTSW 10 42,194,712 (GRCm39) missense probably damaging 1.00
R6972:Afg1l UTSW 10 42,354,370 (GRCm39) missense probably benign 0.00
R7270:Afg1l UTSW 10 42,301,245 (GRCm39) missense probably damaging 1.00
R7271:Afg1l UTSW 10 42,291,544 (GRCm39) critical splice donor site probably null
R7577:Afg1l UTSW 10 42,194,607 (GRCm39) missense probably damaging 1.00
R8458:Afg1l UTSW 10 42,302,517 (GRCm39) missense probably damaging 0.98
R8824:Afg1l UTSW 10 42,314,383 (GRCm39) missense possibly damaging 0.49
R9032:Afg1l UTSW 10 42,194,637 (GRCm39) missense probably damaging 1.00
R9085:Afg1l UTSW 10 42,194,637 (GRCm39) missense probably damaging 1.00
R9443:Afg1l UTSW 10 42,189,587 (GRCm39) missense probably damaging 1.00
Z1176:Afg1l UTSW 10 42,354,349 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGAAGCGATTTGGACAGGTG -3'
(R):5'- AGACCTGTCTAAATGAGCGAATG -3'

Sequencing Primer
(F):5'- CCACTAAGGAACATCAAAAAGAGCGG -3'
(R):5'- CCTGTCTAAATGAGCGAATGAAGTC -3'
Posted On 2016-03-17