Incidental Mutation 'R4887:Afg1l'
ID376992
Institutional Source Beutler Lab
Gene Symbol Afg1l
Ensembl Gene ENSMUSG00000038302
Gene NameAFG1 like ATPase
SynonymsLace1
MMRRC Submission 041979-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4887 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location42312585-42478565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42454378 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 98 (V98I)
Ref Sequence ENSEMBL: ENSMUSP00000036149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041024] [ENSMUST00000133326]
Predicted Effect probably benign
Transcript: ENSMUST00000041024
AA Change: V98I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000036149
Gene: ENSMUSG00000038302
AA Change: V98I

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 74 432 4.4e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133326
AA Change: V98I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123510
Gene: ENSMUSG00000038302
AA Change: V98I

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 73 272 2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151747
SMART Domains Protein: ENSMUSP00000120389
Gene: ENSMUSG00000038302

DomainStartEndE-ValueType
Pfam:AFG1_ATPase 5 300 2e-97 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial integral membrane protein that plays a role in mitochondrial protein homeostasis. The protein contains a P-loop motif and a five-domain structure that is conserved in fly, yeast, and bacteria. It functions to mediate the degradation of nuclear-encoded complex IV subunits. Two conserved estrogen receptor binding sites are located within 2.5 kb of this gene. Polymorphisms in this gene have been associated with bipolar disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,324 I22F possibly damaging Het
2310009B15Rik A C 1: 138,852,165 Y116* probably null Het
4930548H24Rik A G 5: 31,486,252 I109V probably benign Het
Acer3 T C 7: 98,257,701 T91A possibly damaging Het
Adam12 T C 7: 134,172,821 K20E possibly damaging Het
Adamtsl3 T C 7: 82,574,614 V275A possibly damaging Het
Alpk1 C T 3: 127,673,475 G1052R probably damaging Het
Anln A T 9: 22,380,188 S115T possibly damaging Het
Apob T A 12: 8,013,099 N3827K probably damaging Het
Aqr G A 2: 114,150,509 L264F probably damaging Het
Arhgap33 T C 7: 30,532,192 S123G probably damaging Het
Arvcf C T 16: 18,398,113 R333* probably null Het
Brca2 T A 5: 150,556,937 L2724Q probably damaging Het
Btbd11 C T 10: 85,387,378 T17M unknown Het
C2cd6 T A 1: 59,094,734 T43S probably benign Het
Cacna1h A G 17: 25,377,287 V1920A possibly damaging Het
Capsl A T 15: 9,457,772 I26F possibly damaging Het
Card10 A T 15: 78,781,524 V673E possibly damaging Het
Ccar1 A G 10: 62,753,218 S829P unknown Het
Cdc42bpa T C 1: 180,144,635 M1334T possibly damaging Het
Ceacam2 C T 7: 25,520,832 C267Y probably benign Het
Cep68 G A 11: 20,239,239 T591M probably benign Het
Chil4 T C 3: 106,204,144 K218R probably benign Het
Cldn14 G T 16: 93,919,859 T33K possibly damaging Het
Copa T A 1: 172,092,276 C140S probably benign Het
Coq6 T C 12: 84,372,296 L358P probably damaging Het
Cyfip1 C T 7: 55,872,068 P40L probably damaging Het
Dennd2a A C 6: 39,497,159 S414A probably benign Het
Dpm1 T C 2: 168,217,759 N139S probably benign Het
Dpp7 T A 2: 25,352,758 probably null Het
Ednrb T C 14: 103,820,011 I372V possibly damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Fam135a G A 1: 24,024,253 Q1087* probably null Het
Fancg T C 4: 43,006,866 T275A probably benign Het
Fbn1 T A 2: 125,309,774 H2520L probably damaging Het
Fmn2 T C 1: 174,581,961 S587P unknown Het
Foxr2 A G X: 153,130,316 Q61R probably damaging Het
Frrs1 A G 3: 116,902,416 *124W probably null Het
Gm16432 A G 1: 178,103,949 Y478C unknown Het
Gm7535 T A 17: 17,911,071 probably benign Het
Gm884 T C 11: 103,614,872 H2090R probably benign Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Herc3 T C 6: 58,887,499 V706A probably damaging Het
Hist1h4a T C 13: 23,760,952 D69G probably damaging Het
Hivep3 A G 4: 120,122,934 E1723G probably damaging Het
Igsf9b A G 9: 27,322,650 I382V probably benign Het
Ints1 G T 5: 139,771,156 T467N possibly damaging Het
Iqca G A 1: 90,045,701 T783M probably damaging Het
Kng1 A G 16: 23,067,698 K131R possibly damaging Het
Krt35 T C 11: 100,093,130 Y348C probably damaging Het
Ldlrad3 A G 2: 102,113,536 C64R probably damaging Het
Lilr4b C T 10: 51,484,520 A272V possibly damaging Het
Ltn1 A T 16: 87,398,809 C1276* probably null Het
Matn1 G A 4: 130,952,114 A360T probably benign Het
Minpp1 G A 19: 32,498,384 V306I probably benign Het
Mkx G A 18: 6,992,904 R127W probably damaging Het
Mrpl48 G T 7: 100,546,409 probably benign Het
Ms4a2 A G 19: 11,618,429 L166S possibly damaging Het
Mtus2 T A 5: 148,077,103 Y235* probably null Het
Myh4 G T 11: 67,241,054 W113C probably damaging Het
Nav2 T A 7: 49,548,434 C1270* probably null Het
Ncoa5 A G 2: 165,002,150 L111P probably damaging Het
Nup107 T C 10: 117,770,478 Y453C probably damaging Het
Oca2 C T 7: 56,330,358 Q604* probably null Het
Olfr116 A T 17: 37,623,891 V248D probably damaging Het
Olfr1339 A C 4: 118,734,688 H53P probably benign Het
Olfr482 T A 7: 108,095,096 N158I probably benign Het
Olfr525 T C 7: 140,323,101 M134T probably benign Het
Olfr952 T C 9: 39,426,235 T279A possibly damaging Het
Pde3a G T 6: 141,470,942 G514V possibly damaging Het
Pik3cb A T 9: 99,101,328 C76S probably damaging Het
Plk1 T C 7: 122,168,605 V411A probably damaging Het
Pole C T 5: 110,324,753 P1600L probably damaging Het
Prr36 T C 8: 4,210,881 T979A probably benign Het
Rdh7 T A 10: 127,885,721 T229S probably benign Het
Rnpepl1 A T 1: 92,915,113 T140S probably damaging Het
Rps6kc1 A T 1: 190,798,694 S947T probably benign Het
Rtl1 A G 12: 109,591,704 F1234L probably damaging Het
Sdc1 G A 12: 8,791,708 M279I probably damaging Het
Siae T C 9: 37,627,800 L169P possibly damaging Het
Slc22a22 C T 15: 57,249,752 V364I probably benign Het
Sltm G T 9: 70,588,978 V932F probably damaging Het
Smad1 A G 8: 79,349,752 L279P probably damaging Het
Spag17 G T 3: 100,050,831 G935V probably damaging Het
Srgap3 A G 6: 112,746,934 S546P probably damaging Het
Stxbp5 T C 10: 9,809,100 I519V probably benign Het
Syt16 A T 12: 74,129,386 I10F probably damaging Het
Trim43b C G 9: 89,091,312 G123R probably damaging Het
Ubr3 T C 2: 70,013,131 Y1572H probably damaging Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Vmn2r44 A T 7: 8,377,986 W303R probably benign Het
Wdr93 T C 7: 79,785,774 Y684H probably damaging Het
Wnk2 G A 13: 49,071,002 R268C probably damaging Het
Zfp438 C T 18: 5,213,776 C394Y possibly damaging Het
Other mutations in Afg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Afg1l APN 10 42339911 missense possibly damaging 0.86
IGL02041:Afg1l APN 10 42454380 missense probably damaging 0.98
IGL02309:Afg1l APN 10 42454378 missense possibly damaging 0.90
IGL02323:Afg1l APN 10 42454510 nonsense probably null
IGL03088:Afg1l APN 10 42426497 missense probably damaging 1.00
PIT4458001:Afg1l UTSW 10 42454370 nonsense probably null
R0969:Afg1l UTSW 10 42318621 missense probably damaging 1.00
R1665:Afg1l UTSW 10 42426577 missense probably damaging 1.00
R1703:Afg1l UTSW 10 42400399 missense probably damaging 1.00
R1766:Afg1l UTSW 10 42454495 missense probably benign 0.00
R2941:Afg1l UTSW 10 42478295 splice site probably null
R4846:Afg1l UTSW 10 42454494 missense probably benign 0.02
R5668:Afg1l UTSW 10 42360240 missense probably damaging 1.00
R5934:Afg1l UTSW 10 42318686 missense probably damaging 1.00
R6575:Afg1l UTSW 10 42318716 missense probably damaging 1.00
R6972:Afg1l UTSW 10 42478374 missense probably benign 0.00
R7270:Afg1l UTSW 10 42425249 missense probably damaging 1.00
R7271:Afg1l UTSW 10 42415548 critical splice donor site probably null
R7577:Afg1l UTSW 10 42318611 missense probably damaging 1.00
R8458:Afg1l UTSW 10 42426521 missense probably damaging 0.98
Z1176:Afg1l UTSW 10 42478353 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGAAGCGATTTGGACAGGTG -3'
(R):5'- AGACCTGTCTAAATGAGCGAATG -3'

Sequencing Primer
(F):5'- CCACTAAGGAACATCAAAAAGAGCGG -3'
(R):5'- CCTGTCTAAATGAGCGAATGAAGTC -3'
Posted On2016-03-17