Incidental Mutation 'R4887:Gm884'
ID377002
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Namepredicted gene 884
SynonymsLOC380730
MMRRC Submission 041979-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R4887 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location103534577-103621140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103614872 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 2090 (H2090R)
Ref Sequence ENSEMBL: ENSMUSP00000058511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279] [ENSMUST00000167262]
Predicted Effect probably benign
Transcript: ENSMUST00000059279
AA Change: H2090R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: H2090R

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167262
SMART Domains Protein: ENSMUSP00000129662
Gene: ENSMUSG00000034239

DomainStartEndE-ValueType
internal_repeat_1 1 70 1.46e-11 PROSPERO
internal_repeat_1 108 290 1.46e-11 PROSPERO
LRR 601 620 3.09e1 SMART
LRR_TYP 621 644 2.09e-3 SMART
LRR 645 668 4.44e0 SMART
LRR 672 696 8.26e1 SMART
low complexity region 815 826 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Pfam:LRRC37AB_C 1243 1396 1.2e-92 PFAM
low complexity region 1446 1464 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,876,324 I22F possibly damaging Het
2310009B15Rik A C 1: 138,852,165 Y116* probably null Het
4930548H24Rik A G 5: 31,486,252 I109V probably benign Het
Acer3 T C 7: 98,257,701 T91A possibly damaging Het
Adam12 T C 7: 134,172,821 K20E possibly damaging Het
Adamtsl3 T C 7: 82,574,614 V275A possibly damaging Het
Afg1l C T 10: 42,454,378 V98I probably benign Het
Alpk1 C T 3: 127,673,475 G1052R probably damaging Het
Anln A T 9: 22,380,188 S115T possibly damaging Het
Apob T A 12: 8,013,099 N3827K probably damaging Het
Aqr G A 2: 114,150,509 L264F probably damaging Het
Arhgap33 T C 7: 30,532,192 S123G probably damaging Het
Arvcf C T 16: 18,398,113 R333* probably null Het
Brca2 T A 5: 150,556,937 L2724Q probably damaging Het
Btbd11 C T 10: 85,387,378 T17M unknown Het
C2cd6 T A 1: 59,094,734 T43S probably benign Het
Cacna1h A G 17: 25,377,287 V1920A possibly damaging Het
Capsl A T 15: 9,457,772 I26F possibly damaging Het
Card10 A T 15: 78,781,524 V673E possibly damaging Het
Ccar1 A G 10: 62,753,218 S829P unknown Het
Cdc42bpa T C 1: 180,144,635 M1334T possibly damaging Het
Ceacam2 C T 7: 25,520,832 C267Y probably benign Het
Cep68 G A 11: 20,239,239 T591M probably benign Het
Chil4 T C 3: 106,204,144 K218R probably benign Het
Cldn14 G T 16: 93,919,859 T33K possibly damaging Het
Copa T A 1: 172,092,276 C140S probably benign Het
Coq6 T C 12: 84,372,296 L358P probably damaging Het
Cyfip1 C T 7: 55,872,068 P40L probably damaging Het
Dennd2a A C 6: 39,497,159 S414A probably benign Het
Dpm1 T C 2: 168,217,759 N139S probably benign Het
Dpp7 T A 2: 25,352,758 probably null Het
Ednrb T C 14: 103,820,011 I372V possibly damaging Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Fam135a G A 1: 24,024,253 Q1087* probably null Het
Fancg T C 4: 43,006,866 T275A probably benign Het
Fbn1 T A 2: 125,309,774 H2520L probably damaging Het
Fmn2 T C 1: 174,581,961 S587P unknown Het
Foxr2 A G X: 153,130,316 Q61R probably damaging Het
Frrs1 A G 3: 116,902,416 *124W probably null Het
Gm16432 A G 1: 178,103,949 Y478C unknown Het
Gm7535 T A 17: 17,911,071 probably benign Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Herc3 T C 6: 58,887,499 V706A probably damaging Het
Hist1h4a T C 13: 23,760,952 D69G probably damaging Het
Hivep3 A G 4: 120,122,934 E1723G probably damaging Het
Igsf9b A G 9: 27,322,650 I382V probably benign Het
Ints1 G T 5: 139,771,156 T467N possibly damaging Het
Iqca G A 1: 90,045,701 T783M probably damaging Het
Kng1 A G 16: 23,067,698 K131R possibly damaging Het
Krt35 T C 11: 100,093,130 Y348C probably damaging Het
Ldlrad3 A G 2: 102,113,536 C64R probably damaging Het
Lilr4b C T 10: 51,484,520 A272V possibly damaging Het
Ltn1 A T 16: 87,398,809 C1276* probably null Het
Matn1 G A 4: 130,952,114 A360T probably benign Het
Minpp1 G A 19: 32,498,384 V306I probably benign Het
Mkx G A 18: 6,992,904 R127W probably damaging Het
Mrpl48 G T 7: 100,546,409 probably benign Het
Ms4a2 A G 19: 11,618,429 L166S possibly damaging Het
Mtus2 T A 5: 148,077,103 Y235* probably null Het
Myh4 G T 11: 67,241,054 W113C probably damaging Het
Nav2 T A 7: 49,548,434 C1270* probably null Het
Ncoa5 A G 2: 165,002,150 L111P probably damaging Het
Nup107 T C 10: 117,770,478 Y453C probably damaging Het
Oca2 C T 7: 56,330,358 Q604* probably null Het
Olfr116 A T 17: 37,623,891 V248D probably damaging Het
Olfr1339 A C 4: 118,734,688 H53P probably benign Het
Olfr482 T A 7: 108,095,096 N158I probably benign Het
Olfr525 T C 7: 140,323,101 M134T probably benign Het
Olfr952 T C 9: 39,426,235 T279A possibly damaging Het
Pde3a G T 6: 141,470,942 G514V possibly damaging Het
Pik3cb A T 9: 99,101,328 C76S probably damaging Het
Plk1 T C 7: 122,168,605 V411A probably damaging Het
Pole C T 5: 110,324,753 P1600L probably damaging Het
Prr36 T C 8: 4,210,881 T979A probably benign Het
Rdh7 T A 10: 127,885,721 T229S probably benign Het
Rnpepl1 A T 1: 92,915,113 T140S probably damaging Het
Rps6kc1 A T 1: 190,798,694 S947T probably benign Het
Rtl1 A G 12: 109,591,704 F1234L probably damaging Het
Sdc1 G A 12: 8,791,708 M279I probably damaging Het
Siae T C 9: 37,627,800 L169P possibly damaging Het
Slc22a22 C T 15: 57,249,752 V364I probably benign Het
Sltm G T 9: 70,588,978 V932F probably damaging Het
Smad1 A G 8: 79,349,752 L279P probably damaging Het
Spag17 G T 3: 100,050,831 G935V probably damaging Het
Srgap3 A G 6: 112,746,934 S546P probably damaging Het
Stxbp5 T C 10: 9,809,100 I519V probably benign Het
Syt16 A T 12: 74,129,386 I10F probably damaging Het
Trim43b C G 9: 89,091,312 G123R probably damaging Het
Ubr3 T C 2: 70,013,131 Y1572H probably damaging Het
Umodl1 G A 17: 31,008,665 R1324H probably benign Het
Vmn2r44 A T 7: 8,377,986 W303R probably benign Het
Wdr93 T C 7: 79,785,774 Y684H probably damaging Het
Wnk2 G A 13: 49,071,002 R268C probably damaging Het
Zfp438 C T 18: 5,213,776 C394Y possibly damaging Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0646:Gm884 UTSW 11 103613160 nonsense probably null
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1677:Gm884 UTSW 11 103614942 missense probably benign 0.19
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1719:Gm884 UTSW 11 103617071 unclassified probably benign
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3835:Gm884 UTSW 11 103620010 missense unknown
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4633:Gm884 UTSW 11 103619131 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5030:Gm884 UTSW 11 103534849 missense unknown
R5183:Gm884 UTSW 11 103543121 missense probably damaging 0.99
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5647:Gm884 UTSW 11 103617474 unclassified probably benign
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6301:Gm884 UTSW 11 103618930 unclassified probably benign
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R6996:Gm884 UTSW 11 103618757 nonsense probably null
R7028:Gm884 UTSW 11 103614537 missense probably benign 0.28
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
R7405:Gm884 UTSW 11 103615161 missense probably benign 0.02
R7420:Gm884 UTSW 11 103613625 missense probably benign 0.11
R7461:Gm884 UTSW 11 103616290 missense unknown
R7544:Gm884 UTSW 11 103615448 missense probably benign 0.01
R7613:Gm884 UTSW 11 103616290 missense unknown
R7711:Gm884 UTSW 11 103614912 missense probably benign 0.02
R7714:Gm884 UTSW 11 103616893 missense unknown
R7747:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R7814:Gm884 UTSW 11 103614173 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CTGAAAGCACTCCCTCTTTATAGTC -3'
(R):5'- TGTGCAGGAGACCCTAACTC -3'

Sequencing Primer
(F):5'- AGTCTAGAGTTTGACCTACAACC -3'
(R):5'- TGCAGGAGACCCTAACTCAGATTTC -3'
Posted On2016-03-17