Incidental Mutation 'R4887:Card10'
ID 377014
Institutional Source Beutler Lab
Gene Symbol Card10
Ensembl Gene ENSMUSG00000033170
Gene Name caspase recruitment domain family, member 10
Synonyms Bimp1, CARMA3
MMRRC Submission 041979-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R4887 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 78659338-78687242 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78665724 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 673 (V673E)
Ref Sequence ENSEMBL: ENSMUSP00000129513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164826] [ENSMUST00000170584]
AlphaFold P58660
Predicted Effect possibly damaging
Transcript: ENSMUST00000164826
AA Change: V673E

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129513
Gene: ENSMUSG00000033170
AA Change: V673E

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
Pfam:CARD 77 163 1.1e-22 PFAM
coiled coil region 188 498 N/A INTRINSIC
low complexity region 508 523 N/A INTRINSIC
low complexity region 607 614 N/A INTRINSIC
low complexity region 692 706 N/A INTRINSIC
PDB:3SHW|A 744 1055 1e-7 PDB
Blast:SH3 747 812 8e-8 BLAST
Blast:GuKc 883 1045 1e-19 BLAST
low complexity region 1057 1068 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170584
AA Change: V624E

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131003
Gene: ENSMUSG00000033170
AA Change: V624E

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:CARD 28 114 5.6e-23 PFAM
coiled coil region 139 449 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
low complexity region 558 565 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
PDB:3SHW|A 695 1006 1e-7 PDB
Blast:SH3 698 763 7e-8 BLAST
Blast:GuKc 834 996 1e-19 BLAST
low complexity region 1008 1019 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The caspase recruitment domain (CARD) is a protein module that consists of 6 or 7 antiparallel alpha helices. It participates in apoptosis signaling through highly specific protein-protein homophilic interactions. Like several other CARD proteins, CARD10 belongs to the membrane-associated guanylate kinase (MAGUK) family and activates NF-kappa-B (NFKB; see MIM 164011) through BCL10 (MIM 603517) (Wang et al., 2001 [PubMed 11259443]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit partial penetrance of anencephaly and subsequent perinatal lethality of anencephalic embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A C 1: 138,779,903 (GRCm39) Y116* probably null Het
Abtb3 C T 10: 85,223,242 (GRCm39) T17M unknown Het
Acer3 T C 7: 97,906,908 (GRCm39) T91A possibly damaging Het
Acsbg3 A T 17: 57,183,324 (GRCm39) I22F possibly damaging Het
Adam12 T C 7: 133,774,550 (GRCm39) K20E possibly damaging Het
Adamtsl3 T C 7: 82,223,822 (GRCm39) V275A possibly damaging Het
Afg1l C T 10: 42,330,374 (GRCm39) V98I probably benign Het
Ajm1 G A 2: 25,469,759 (GRCm39) R51C possibly damaging Het
Alpk1 C T 3: 127,467,124 (GRCm39) G1052R probably damaging Het
Anln A T 9: 22,291,484 (GRCm39) S115T possibly damaging Het
Apob T A 12: 8,063,099 (GRCm39) N3827K probably damaging Het
Aqr G A 2: 113,980,990 (GRCm39) L264F probably damaging Het
Arhgap33 T C 7: 30,231,617 (GRCm39) S123G probably damaging Het
Arvcf C T 16: 18,216,863 (GRCm39) R333* probably null Het
Brca2 T A 5: 150,480,402 (GRCm39) L2724Q probably damaging Het
C2cd6 T A 1: 59,133,893 (GRCm39) T43S probably benign Het
Cacna1h A G 17: 25,596,261 (GRCm39) V1920A possibly damaging Het
Capsl A T 15: 9,457,858 (GRCm39) I26F possibly damaging Het
Catspere2 A G 1: 177,931,515 (GRCm39) Y478C unknown Het
Ccar1 A G 10: 62,588,997 (GRCm39) S829P unknown Het
Ccdc121 A G 5: 31,643,596 (GRCm39) I109V probably benign Het
Cdc42bpa T C 1: 179,972,200 (GRCm39) M1334T possibly damaging Het
Ceacam2 C T 7: 25,220,257 (GRCm39) C267Y probably benign Het
Cep68 G A 11: 20,189,239 (GRCm39) T591M probably benign Het
Chil4 T C 3: 106,111,460 (GRCm39) K218R probably benign Het
Cldn14 G T 16: 93,716,747 (GRCm39) T33K possibly damaging Het
Copa T A 1: 171,919,843 (GRCm39) C140S probably benign Het
Coq6 T C 12: 84,419,070 (GRCm39) L358P probably damaging Het
Cyfip1 C T 7: 55,521,816 (GRCm39) P40L probably damaging Het
Dennd2a A C 6: 39,474,093 (GRCm39) S414A probably benign Het
Dpm1 T C 2: 168,059,679 (GRCm39) N139S probably benign Het
Dpp7 T A 2: 25,242,770 (GRCm39) probably null Het
Ednrb T C 14: 104,057,447 (GRCm39) I372V possibly damaging Het
Edrf1 G T 7: 133,260,339 (GRCm39) M83I probably damaging Het
Fam135a G A 1: 24,063,334 (GRCm39) Q1087* probably null Het
Fancg T C 4: 43,006,866 (GRCm39) T275A probably benign Het
Fbn1 T A 2: 125,151,694 (GRCm39) H2520L probably damaging Het
Fmn2 T C 1: 174,409,527 (GRCm39) S587P unknown Het
Foxr2 A G X: 151,913,312 (GRCm39) Q61R probably damaging Het
Frrs1 A G 3: 116,696,065 (GRCm39) *124W probably null Het
Gm7535 T A 17: 18,131,333 (GRCm39) probably benign Het
H4c1 T C 13: 23,944,935 (GRCm39) D69G probably damaging Het
Herc3 T C 6: 58,864,484 (GRCm39) V706A probably damaging Het
Hivep3 A G 4: 119,980,131 (GRCm39) E1723G probably damaging Het
Igsf9b A G 9: 27,233,946 (GRCm39) I382V probably benign Het
Ints1 G T 5: 139,756,911 (GRCm39) T467N possibly damaging Het
Iqca1 G A 1: 89,973,423 (GRCm39) T783M probably damaging Het
Kng1 A G 16: 22,886,448 (GRCm39) K131R possibly damaging Het
Krt35 T C 11: 99,983,956 (GRCm39) Y348C probably damaging Het
Ldlrad3 A G 2: 101,943,881 (GRCm39) C64R probably damaging Het
Lilrb4b C T 10: 51,360,616 (GRCm39) A272V possibly damaging Het
Lrrc37 T C 11: 103,505,698 (GRCm39) H2090R probably benign Het
Ltn1 A T 16: 87,195,697 (GRCm39) C1276* probably null Het
Matn1 G A 4: 130,679,425 (GRCm39) A360T probably benign Het
Minpp1 G A 19: 32,475,784 (GRCm39) V306I probably benign Het
Mkx G A 18: 6,992,904 (GRCm39) R127W probably damaging Het
Mrpl48 G T 7: 100,195,616 (GRCm39) probably benign Het
Ms4a2 A G 19: 11,595,793 (GRCm39) L166S possibly damaging Het
Mtus2 T A 5: 148,013,913 (GRCm39) Y235* probably null Het
Myh4 G T 11: 67,131,880 (GRCm39) W113C probably damaging Het
Nav2 T A 7: 49,198,182 (GRCm39) C1270* probably null Het
Ncoa5 A G 2: 164,844,070 (GRCm39) L111P probably damaging Het
Nup107 T C 10: 117,606,383 (GRCm39) Y453C probably damaging Het
Oca2 C T 7: 55,980,106 (GRCm39) Q604* probably null Het
Or13a19 T C 7: 139,903,014 (GRCm39) M134T probably benign Het
Or13p5 A C 4: 118,591,885 (GRCm39) H53P probably benign Het
Or14j10 A T 17: 37,934,782 (GRCm39) V248D probably damaging Het
Or5p58 T A 7: 107,694,303 (GRCm39) N158I probably benign Het
Or8g33 T C 9: 39,337,531 (GRCm39) T279A possibly damaging Het
Pde3a G T 6: 141,416,668 (GRCm39) G514V possibly damaging Het
Pik3cb A T 9: 98,983,381 (GRCm39) C76S probably damaging Het
Plk1 T C 7: 121,767,828 (GRCm39) V411A probably damaging Het
Pole C T 5: 110,472,619 (GRCm39) P1600L probably damaging Het
Prr36 T C 8: 4,260,881 (GRCm39) T979A probably benign Het
Rdh7 T A 10: 127,721,590 (GRCm39) T229S probably benign Het
Rnpepl1 A T 1: 92,842,835 (GRCm39) T140S probably damaging Het
Rps6kc1 A T 1: 190,530,891 (GRCm39) S947T probably benign Het
Rtl1 A G 12: 109,558,138 (GRCm39) F1234L probably damaging Het
Sdc1 G A 12: 8,841,708 (GRCm39) M279I probably damaging Het
Siae T C 9: 37,539,096 (GRCm39) L169P possibly damaging Het
Slc22a22 C T 15: 57,113,148 (GRCm39) V364I probably benign Het
Sltm G T 9: 70,496,260 (GRCm39) V932F probably damaging Het
Smad1 A G 8: 80,076,381 (GRCm39) L279P probably damaging Het
Spag17 G T 3: 99,958,147 (GRCm39) G935V probably damaging Het
Srgap3 A G 6: 112,723,895 (GRCm39) S546P probably damaging Het
Stxbp5 T C 10: 9,684,844 (GRCm39) I519V probably benign Het
Syt16 A T 12: 74,176,160 (GRCm39) I10F probably damaging Het
Trim43b C G 9: 88,973,365 (GRCm39) G123R probably damaging Het
Ubr3 T C 2: 69,843,475 (GRCm39) Y1572H probably damaging Het
Umodl1 G A 17: 31,227,639 (GRCm39) R1324H probably benign Het
Vmn2r44 A T 7: 8,380,985 (GRCm39) W303R probably benign Het
Wdr93 T C 7: 79,435,522 (GRCm39) Y684H probably damaging Het
Wnk2 G A 13: 49,224,478 (GRCm39) R268C probably damaging Het
Zfp438 C T 18: 5,213,776 (GRCm39) C394Y possibly damaging Het
Other mutations in Card10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02061:Card10 APN 15 78,662,415 (GRCm39) missense probably damaging 1.00
IGL02804:Card10 APN 15 78,686,649 (GRCm39) missense probably damaging 1.00
PIT4366001:Card10 UTSW 15 78,671,631 (GRCm39) missense probably benign 0.14
R0529:Card10 UTSW 15 78,664,675 (GRCm39) critical splice donor site probably null
R0571:Card10 UTSW 15 78,671,601 (GRCm39) missense possibly damaging 0.88
R1118:Card10 UTSW 15 78,686,643 (GRCm39) missense possibly damaging 0.90
R1444:Card10 UTSW 15 78,672,041 (GRCm39) splice site probably benign
R1632:Card10 UTSW 15 78,675,420 (GRCm39) nonsense probably null
R1669:Card10 UTSW 15 78,678,153 (GRCm39) missense probably benign 0.20
R1862:Card10 UTSW 15 78,664,714 (GRCm39) missense probably damaging 1.00
R1863:Card10 UTSW 15 78,664,714 (GRCm39) missense probably damaging 1.00
R1997:Card10 UTSW 15 78,678,175 (GRCm39) missense probably damaging 0.99
R2046:Card10 UTSW 15 78,671,673 (GRCm39) missense possibly damaging 0.91
R2084:Card10 UTSW 15 78,677,171 (GRCm39) missense possibly damaging 0.81
R2509:Card10 UTSW 15 78,664,473 (GRCm39) missense probably benign 0.00
R2511:Card10 UTSW 15 78,664,473 (GRCm39) missense probably benign 0.00
R4274:Card10 UTSW 15 78,664,714 (GRCm39) missense probably damaging 1.00
R4970:Card10 UTSW 15 78,686,580 (GRCm39) critical splice donor site probably null
R5098:Card10 UTSW 15 78,660,917 (GRCm39) missense probably benign 0.37
R5112:Card10 UTSW 15 78,686,580 (GRCm39) critical splice donor site probably null
R5243:Card10 UTSW 15 78,664,872 (GRCm39) missense possibly damaging 0.70
R5256:Card10 UTSW 15 78,662,451 (GRCm39) missense probably damaging 0.98
R5985:Card10 UTSW 15 78,675,411 (GRCm39) missense probably benign 0.01
R6089:Card10 UTSW 15 78,686,614 (GRCm39) missense probably benign 0.02
R6357:Card10 UTSW 15 78,683,579 (GRCm39) missense probably damaging 1.00
R6545:Card10 UTSW 15 78,661,010 (GRCm39) missense probably damaging 1.00
R6865:Card10 UTSW 15 78,686,822 (GRCm39) missense possibly damaging 0.70
R6907:Card10 UTSW 15 78,671,671 (GRCm39) missense possibly damaging 0.82
R6920:Card10 UTSW 15 78,686,609 (GRCm39) nonsense probably null
R7913:Card10 UTSW 15 78,665,303 (GRCm39) missense possibly damaging 0.63
R8258:Card10 UTSW 15 78,660,884 (GRCm39) missense probably damaging 1.00
R8259:Card10 UTSW 15 78,660,884 (GRCm39) missense probably damaging 1.00
R9246:Card10 UTSW 15 78,673,036 (GRCm39) missense possibly damaging 0.95
R9661:Card10 UTSW 15 78,683,318 (GRCm39) missense probably damaging 1.00
Z1177:Card10 UTSW 15 78,679,528 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GTCAGATGTTAGTCACTGCAGG -3'
(R):5'- AGATCCATGGTCTCTTCAGGC -3'

Sequencing Primer
(F):5'- TAGTCACTGCAGGCTGAGG -3'
(R):5'- GTCTCTTCAGGCAGCAGAATCATG -3'
Posted On 2016-03-17