Incidental Mutation 'R4887:Arvcf'
ID 377015
Institutional Source Beutler Lab
Gene Symbol Arvcf
Ensembl Gene ENSMUSG00000000325
Gene Name armadillo repeat gene deleted in velocardiofacial syndrome
Synonyms
MMRRC Submission 041979-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4887 (G1)
Quality Score 144
Status Not validated
Chromosome 16
Chromosomal Location 18166046-18225826 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 18216863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 333 (R333*)
Ref Sequence ENSEMBL: ENSMUSP00000155883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090103] [ENSMUST00000115610] [ENSMUST00000115612] [ENSMUST00000115613] [ENSMUST00000115614] [ENSMUST00000150253] [ENSMUST00000232025]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000090103
AA Change: R397*
SMART Domains Protein: ENSMUSP00000087562
Gene: ENSMUSG00000000325
AA Change: R397*

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115610
AA Change: R333*
SMART Domains Protein: ENSMUSP00000111273
Gene: ENSMUSG00000000325
AA Change: R333*

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
ARM 327 367 4.48e-7 SMART
ARM 370 411 3.31e-10 SMART
Blast:ARM 412 469 1e-20 BLAST
ARM 472 518 2.1e1 SMART
low complexity region 555 563 N/A INTRINSIC
ARM 582 623 9.55e1 SMART
ARM 629 669 4.05e-5 SMART
ARM 720 762 3.03e0 SMART
low complexity region 857 875 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115612
AA Change: R397*
SMART Domains Protein: ENSMUSP00000111275
Gene: ENSMUSG00000000325
AA Change: R397*

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115613
AA Change: R397*
SMART Domains Protein: ENSMUSP00000111276
Gene: ENSMUSG00000000325
AA Change: R397*

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115614
AA Change: R397*
SMART Domains Protein: ENSMUSP00000111278
Gene: ENSMUSG00000000325
AA Change: R397*

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150484
Predicted Effect probably null
Transcript: ENSMUST00000150253
AA Change: R333*
Predicted Effect probably null
Transcript: ENSMUST00000232025
AA Change: R333*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231791
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo Repeat gene deleted in Velo-Cardio-Facial syndrome (ARVCF) is a member of the catenin family. This family plays an important role in the formation of adherens junction complexes, which are thought to facilitate communication between the inside and outside environments of a cell. The ARVCF gene was isolated in the search for the genetic defect responsible for the autosomal dominant Velo-Cardio-Facial syndrome (VCFS), a relatively common human disorder with phenotypic features including cleft palate, conotruncal heart defects and facial dysmorphology. The ARVCF gene encodes a protein containing two motifs, a coiled coil domain in the N-terminus and a 10 armadillo repeat sequence in the midregion. Since these sequences can facilitate protein-protein interactions ARVCF is thought to function in a protein complex. In addition, ARVCF contains a predicted nuclear-targeting sequence suggesting that it may have a function as a nuclear protein. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele display abnormal gait and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A C 1: 138,779,903 (GRCm39) Y116* probably null Het
Abtb3 C T 10: 85,223,242 (GRCm39) T17M unknown Het
Acer3 T C 7: 97,906,908 (GRCm39) T91A possibly damaging Het
Acsbg3 A T 17: 57,183,324 (GRCm39) I22F possibly damaging Het
Adam12 T C 7: 133,774,550 (GRCm39) K20E possibly damaging Het
Adamtsl3 T C 7: 82,223,822 (GRCm39) V275A possibly damaging Het
Afg1l C T 10: 42,330,374 (GRCm39) V98I probably benign Het
Ajm1 G A 2: 25,469,759 (GRCm39) R51C possibly damaging Het
Alpk1 C T 3: 127,467,124 (GRCm39) G1052R probably damaging Het
Anln A T 9: 22,291,484 (GRCm39) S115T possibly damaging Het
Apob T A 12: 8,063,099 (GRCm39) N3827K probably damaging Het
Aqr G A 2: 113,980,990 (GRCm39) L264F probably damaging Het
Arhgap33 T C 7: 30,231,617 (GRCm39) S123G probably damaging Het
Brca2 T A 5: 150,480,402 (GRCm39) L2724Q probably damaging Het
C2cd6 T A 1: 59,133,893 (GRCm39) T43S probably benign Het
Cacna1h A G 17: 25,596,261 (GRCm39) V1920A possibly damaging Het
Capsl A T 15: 9,457,858 (GRCm39) I26F possibly damaging Het
Card10 A T 15: 78,665,724 (GRCm39) V673E possibly damaging Het
Catspere2 A G 1: 177,931,515 (GRCm39) Y478C unknown Het
Ccar1 A G 10: 62,588,997 (GRCm39) S829P unknown Het
Ccdc121 A G 5: 31,643,596 (GRCm39) I109V probably benign Het
Cdc42bpa T C 1: 179,972,200 (GRCm39) M1334T possibly damaging Het
Ceacam2 C T 7: 25,220,257 (GRCm39) C267Y probably benign Het
Cep68 G A 11: 20,189,239 (GRCm39) T591M probably benign Het
Chil4 T C 3: 106,111,460 (GRCm39) K218R probably benign Het
Cldn14 G T 16: 93,716,747 (GRCm39) T33K possibly damaging Het
Copa T A 1: 171,919,843 (GRCm39) C140S probably benign Het
Coq6 T C 12: 84,419,070 (GRCm39) L358P probably damaging Het
Cyfip1 C T 7: 55,521,816 (GRCm39) P40L probably damaging Het
Dennd2a A C 6: 39,474,093 (GRCm39) S414A probably benign Het
Dpm1 T C 2: 168,059,679 (GRCm39) N139S probably benign Het
Dpp7 T A 2: 25,242,770 (GRCm39) probably null Het
Ednrb T C 14: 104,057,447 (GRCm39) I372V possibly damaging Het
Edrf1 G T 7: 133,260,339 (GRCm39) M83I probably damaging Het
Fam135a G A 1: 24,063,334 (GRCm39) Q1087* probably null Het
Fancg T C 4: 43,006,866 (GRCm39) T275A probably benign Het
Fbn1 T A 2: 125,151,694 (GRCm39) H2520L probably damaging Het
Fmn2 T C 1: 174,409,527 (GRCm39) S587P unknown Het
Foxr2 A G X: 151,913,312 (GRCm39) Q61R probably damaging Het
Frrs1 A G 3: 116,696,065 (GRCm39) *124W probably null Het
Gm7535 T A 17: 18,131,333 (GRCm39) probably benign Het
H4c1 T C 13: 23,944,935 (GRCm39) D69G probably damaging Het
Herc3 T C 6: 58,864,484 (GRCm39) V706A probably damaging Het
Hivep3 A G 4: 119,980,131 (GRCm39) E1723G probably damaging Het
Igsf9b A G 9: 27,233,946 (GRCm39) I382V probably benign Het
Ints1 G T 5: 139,756,911 (GRCm39) T467N possibly damaging Het
Iqca1 G A 1: 89,973,423 (GRCm39) T783M probably damaging Het
Kng1 A G 16: 22,886,448 (GRCm39) K131R possibly damaging Het
Krt35 T C 11: 99,983,956 (GRCm39) Y348C probably damaging Het
Ldlrad3 A G 2: 101,943,881 (GRCm39) C64R probably damaging Het
Lilrb4b C T 10: 51,360,616 (GRCm39) A272V possibly damaging Het
Lrrc37 T C 11: 103,505,698 (GRCm39) H2090R probably benign Het
Ltn1 A T 16: 87,195,697 (GRCm39) C1276* probably null Het
Matn1 G A 4: 130,679,425 (GRCm39) A360T probably benign Het
Minpp1 G A 19: 32,475,784 (GRCm39) V306I probably benign Het
Mkx G A 18: 6,992,904 (GRCm39) R127W probably damaging Het
Mrpl48 G T 7: 100,195,616 (GRCm39) probably benign Het
Ms4a2 A G 19: 11,595,793 (GRCm39) L166S possibly damaging Het
Mtus2 T A 5: 148,013,913 (GRCm39) Y235* probably null Het
Myh4 G T 11: 67,131,880 (GRCm39) W113C probably damaging Het
Nav2 T A 7: 49,198,182 (GRCm39) C1270* probably null Het
Ncoa5 A G 2: 164,844,070 (GRCm39) L111P probably damaging Het
Nup107 T C 10: 117,606,383 (GRCm39) Y453C probably damaging Het
Oca2 C T 7: 55,980,106 (GRCm39) Q604* probably null Het
Or13a19 T C 7: 139,903,014 (GRCm39) M134T probably benign Het
Or13p5 A C 4: 118,591,885 (GRCm39) H53P probably benign Het
Or14j10 A T 17: 37,934,782 (GRCm39) V248D probably damaging Het
Or5p58 T A 7: 107,694,303 (GRCm39) N158I probably benign Het
Or8g33 T C 9: 39,337,531 (GRCm39) T279A possibly damaging Het
Pde3a G T 6: 141,416,668 (GRCm39) G514V possibly damaging Het
Pik3cb A T 9: 98,983,381 (GRCm39) C76S probably damaging Het
Plk1 T C 7: 121,767,828 (GRCm39) V411A probably damaging Het
Pole C T 5: 110,472,619 (GRCm39) P1600L probably damaging Het
Prr36 T C 8: 4,260,881 (GRCm39) T979A probably benign Het
Rdh7 T A 10: 127,721,590 (GRCm39) T229S probably benign Het
Rnpepl1 A T 1: 92,842,835 (GRCm39) T140S probably damaging Het
Rps6kc1 A T 1: 190,530,891 (GRCm39) S947T probably benign Het
Rtl1 A G 12: 109,558,138 (GRCm39) F1234L probably damaging Het
Sdc1 G A 12: 8,841,708 (GRCm39) M279I probably damaging Het
Siae T C 9: 37,539,096 (GRCm39) L169P possibly damaging Het
Slc22a22 C T 15: 57,113,148 (GRCm39) V364I probably benign Het
Sltm G T 9: 70,496,260 (GRCm39) V932F probably damaging Het
Smad1 A G 8: 80,076,381 (GRCm39) L279P probably damaging Het
Spag17 G T 3: 99,958,147 (GRCm39) G935V probably damaging Het
Srgap3 A G 6: 112,723,895 (GRCm39) S546P probably damaging Het
Stxbp5 T C 10: 9,684,844 (GRCm39) I519V probably benign Het
Syt16 A T 12: 74,176,160 (GRCm39) I10F probably damaging Het
Trim43b C G 9: 88,973,365 (GRCm39) G123R probably damaging Het
Ubr3 T C 2: 69,843,475 (GRCm39) Y1572H probably damaging Het
Umodl1 G A 17: 31,227,639 (GRCm39) R1324H probably benign Het
Vmn2r44 A T 7: 8,380,985 (GRCm39) W303R probably benign Het
Wdr93 T C 7: 79,435,522 (GRCm39) Y684H probably damaging Het
Wnk2 G A 13: 49,224,478 (GRCm39) R268C probably damaging Het
Zfp438 C T 18: 5,213,776 (GRCm39) C394Y possibly damaging Het
Other mutations in Arvcf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Arvcf APN 16 18,222,650 (GRCm39) missense probably damaging 1.00
IGL02901:Arvcf APN 16 18,216,992 (GRCm39) missense probably damaging 0.99
IGL03218:Arvcf APN 16 18,222,875 (GRCm39) splice site probably benign
IGL03239:Arvcf APN 16 18,214,932 (GRCm39) missense probably damaging 1.00
PIT4466001:Arvcf UTSW 16 18,221,699 (GRCm39) missense possibly damaging 0.91
PIT4472001:Arvcf UTSW 16 18,221,699 (GRCm39) missense possibly damaging 0.91
R0045:Arvcf UTSW 16 18,222,208 (GRCm39) missense probably benign 0.40
R0068:Arvcf UTSW 16 18,214,819 (GRCm39) splice site probably benign
R0068:Arvcf UTSW 16 18,214,819 (GRCm39) splice site probably benign
R0873:Arvcf UTSW 16 18,218,955 (GRCm39) nonsense probably null
R1227:Arvcf UTSW 16 18,207,169 (GRCm39) missense probably benign 0.00
R1495:Arvcf UTSW 16 18,207,251 (GRCm39) missense probably damaging 0.96
R1717:Arvcf UTSW 16 18,220,319 (GRCm39) missense possibly damaging 0.52
R2021:Arvcf UTSW 16 18,218,482 (GRCm39) missense probably damaging 1.00
R3873:Arvcf UTSW 16 18,221,783 (GRCm39) missense probably damaging 1.00
R4095:Arvcf UTSW 16 18,220,327 (GRCm39) missense probably damaging 1.00
R4280:Arvcf UTSW 16 18,216,741 (GRCm39) missense probably damaging 1.00
R4496:Arvcf UTSW 16 18,223,932 (GRCm39) missense probably damaging 0.96
R5068:Arvcf UTSW 16 18,217,736 (GRCm39) missense probably damaging 1.00
R5069:Arvcf UTSW 16 18,217,736 (GRCm39) missense probably damaging 1.00
R5070:Arvcf UTSW 16 18,217,736 (GRCm39) missense probably damaging 1.00
R5322:Arvcf UTSW 16 18,215,508 (GRCm39) missense probably benign 0.00
R5400:Arvcf UTSW 16 18,217,820 (GRCm39) missense probably benign 0.17
R6376:Arvcf UTSW 16 18,223,882 (GRCm39) missense probably damaging 0.98
R6771:Arvcf UTSW 16 18,222,614 (GRCm39) missense probably benign
R7106:Arvcf UTSW 16 18,217,799 (GRCm39) missense probably damaging 0.99
R7176:Arvcf UTSW 16 18,218,477 (GRCm39) missense probably damaging 1.00
R7202:Arvcf UTSW 16 18,223,948 (GRCm39) missense probably damaging 1.00
R7412:Arvcf UTSW 16 18,220,350 (GRCm39) missense probably benign 0.03
R7737:Arvcf UTSW 16 18,214,966 (GRCm39) missense probably damaging 1.00
R7783:Arvcf UTSW 16 18,207,063 (GRCm39) missense probably benign 0.30
R8852:Arvcf UTSW 16 18,222,203 (GRCm39) missense probably benign 0.05
R8933:Arvcf UTSW 16 18,218,845 (GRCm39) missense probably damaging 1.00
R8958:Arvcf UTSW 16 18,221,376 (GRCm39) missense probably damaging 1.00
R9043:Arvcf UTSW 16 18,218,452 (GRCm39) missense probably damaging 1.00
R9258:Arvcf UTSW 16 18,216,957 (GRCm39) missense probably damaging 1.00
R9414:Arvcf UTSW 16 18,215,580 (GRCm39) missense probably damaging 1.00
Z1088:Arvcf UTSW 16 18,221,391 (GRCm39) missense probably damaging 1.00
Z1177:Arvcf UTSW 16 18,207,164 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGATAGAAGAGCGTCCC -3'
(R):5'- TCACGGACCTCATTGTCAC -3'

Sequencing Primer
(F):5'- TGATAGAAGAGCGTCCCCCATTTC -3'
(R):5'- ACCTCATTGTCACGGGCC -3'
Posted On 2016-03-17