Incidental Mutation 'R4887:Cacna1h'
ID 377020
Institutional Source Beutler Lab
Gene Symbol Cacna1h
Ensembl Gene ENSMUSG00000024112
Gene Name calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms alpha13.2, T-type Cav3.2, Cav3.2
MMRRC Submission 041979-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4887 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 25593259-25652757 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25596261 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1920 (V1920A)
Ref Sequence ENSEMBL: ENSMUSP00000125541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024999] [ENSMUST00000078496] [ENSMUST00000159048] [ENSMUST00000159610] [ENSMUST00000160377] [ENSMUST00000160485] [ENSMUST00000160920] [ENSMUST00000162021]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024999
SMART Domains Protein: ENSMUSP00000024999
Gene: ENSMUSG00000033200

DomainStartEndE-ValueType
Tryp_SPc 29 257 1.06e-87 SMART
transmembrane domain 274 296 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000078496
AA Change: V1920A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077586
Gene: ENSMUSG00000024112
AA Change: V1920A

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 138 418 8.4e-65 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 824 1011 4.7e-46 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1341 1565 4.5e-56 PFAM
low complexity region 1576 1602 N/A INTRINSIC
Pfam:Ion_trans 1656 1864 7.8e-48 PFAM
Pfam:PKD_channel 1714 1871 1.2e-10 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159048
AA Change: V1814A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123741
Gene: ENSMUSG00000024112
AA Change: V1814A

DomainStartEndE-ValueType
Pfam:Ion_trans 32 312 8e-65 PFAM
low complexity region 394 405 N/A INTRINSIC
low complexity region 409 425 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 602 617 N/A INTRINSIC
Pfam:Ion_trans 718 905 4.6e-46 PFAM
low complexity region 1024 1041 N/A INTRINSIC
low complexity region 1142 1153 N/A INTRINSIC
Pfam:Ion_trans 1235 1459 4.3e-56 PFAM
low complexity region 1470 1496 N/A INTRINSIC
Pfam:PKD_channel 1524 1608 1.6e-6 PFAM
Pfam:Ion_trans 1550 1758 7.6e-48 PFAM
Pfam:PKD_channel 1609 1765 1.2e-10 PFAM
Blast:Tryp_SPc 1809 1854 9e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159331
Predicted Effect possibly damaging
Transcript: ENSMUST00000159610
AA Change: V1920A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125541
Gene: ENSMUSG00000024112
AA Change: V1920A

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 99 430 7e-79 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 789 1023 2.4e-58 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1304 1577 4.5e-65 PFAM
Pfam:Ion_trans 1621 1876 4.2e-59 PFAM
Pfam:PKD_channel 1629 1715 9.3e-7 PFAM
Pfam:PKD_channel 1713 1871 2.2e-11 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160377
SMART Domains Protein: ENSMUSP00000124008
Gene: ENSMUSG00000033200

DomainStartEndE-ValueType
Tryp_SPc 4 154 1.79e-30 SMART
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160485
SMART Domains Protein: ENSMUSP00000124721
Gene: ENSMUSG00000033200

DomainStartEndE-ValueType
Tryp_SPc 4 154 1.79e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160920
SMART Domains Protein: ENSMUSP00000123828
Gene: ENSMUSG00000033200

DomainStartEndE-ValueType
Tryp_SPc 1 184 7.18e-44 SMART
transmembrane domain 201 223 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161035
AA Change: V213A
SMART Domains Protein: ENSMUSP00000123906
Gene: ENSMUSG00000024112
AA Change: V213A

DomainStartEndE-ValueType
Pfam:Ion_trans 1 73 2.1e-9 PFAM
Pfam:Ion_trans 72 170 2.8e-17 PFAM
Blast:Tryp_SPc 209 291 3e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161658
Predicted Effect probably benign
Transcript: ENSMUST00000162021
SMART Domains Protein: ENSMUSP00000125180
Gene: ENSMUSG00000033200

DomainStartEndE-ValueType
Tryp_SPc 5 111 2.35e-4 SMART
transmembrane domain 128 150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-dependent Ca(2+) channels mediate the entry of Ca(2+) ions into excitable cells and are involved in a variety of Ca(2+)-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. The protein encoded by this gene is an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutation of this locus results in constitutive coronary arteriole contraction and focal myocardial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A C 1: 138,779,903 (GRCm39) Y116* probably null Het
Abtb3 C T 10: 85,223,242 (GRCm39) T17M unknown Het
Acer3 T C 7: 97,906,908 (GRCm39) T91A possibly damaging Het
Acsbg3 A T 17: 57,183,324 (GRCm39) I22F possibly damaging Het
Adam12 T C 7: 133,774,550 (GRCm39) K20E possibly damaging Het
Adamtsl3 T C 7: 82,223,822 (GRCm39) V275A possibly damaging Het
Afg1l C T 10: 42,330,374 (GRCm39) V98I probably benign Het
Ajm1 G A 2: 25,469,759 (GRCm39) R51C possibly damaging Het
Alpk1 C T 3: 127,467,124 (GRCm39) G1052R probably damaging Het
Anln A T 9: 22,291,484 (GRCm39) S115T possibly damaging Het
Apob T A 12: 8,063,099 (GRCm39) N3827K probably damaging Het
Aqr G A 2: 113,980,990 (GRCm39) L264F probably damaging Het
Arhgap33 T C 7: 30,231,617 (GRCm39) S123G probably damaging Het
Arvcf C T 16: 18,216,863 (GRCm39) R333* probably null Het
Brca2 T A 5: 150,480,402 (GRCm39) L2724Q probably damaging Het
C2cd6 T A 1: 59,133,893 (GRCm39) T43S probably benign Het
Capsl A T 15: 9,457,858 (GRCm39) I26F possibly damaging Het
Card10 A T 15: 78,665,724 (GRCm39) V673E possibly damaging Het
Catspere2 A G 1: 177,931,515 (GRCm39) Y478C unknown Het
Ccar1 A G 10: 62,588,997 (GRCm39) S829P unknown Het
Ccdc121 A G 5: 31,643,596 (GRCm39) I109V probably benign Het
Cdc42bpa T C 1: 179,972,200 (GRCm39) M1334T possibly damaging Het
Ceacam2 C T 7: 25,220,257 (GRCm39) C267Y probably benign Het
Cep68 G A 11: 20,189,239 (GRCm39) T591M probably benign Het
Chil4 T C 3: 106,111,460 (GRCm39) K218R probably benign Het
Cldn14 G T 16: 93,716,747 (GRCm39) T33K possibly damaging Het
Copa T A 1: 171,919,843 (GRCm39) C140S probably benign Het
Coq6 T C 12: 84,419,070 (GRCm39) L358P probably damaging Het
Cyfip1 C T 7: 55,521,816 (GRCm39) P40L probably damaging Het
Dennd2a A C 6: 39,474,093 (GRCm39) S414A probably benign Het
Dpm1 T C 2: 168,059,679 (GRCm39) N139S probably benign Het
Dpp7 T A 2: 25,242,770 (GRCm39) probably null Het
Ednrb T C 14: 104,057,447 (GRCm39) I372V possibly damaging Het
Edrf1 G T 7: 133,260,339 (GRCm39) M83I probably damaging Het
Fam135a G A 1: 24,063,334 (GRCm39) Q1087* probably null Het
Fancg T C 4: 43,006,866 (GRCm39) T275A probably benign Het
Fbn1 T A 2: 125,151,694 (GRCm39) H2520L probably damaging Het
Fmn2 T C 1: 174,409,527 (GRCm39) S587P unknown Het
Foxr2 A G X: 151,913,312 (GRCm39) Q61R probably damaging Het
Frrs1 A G 3: 116,696,065 (GRCm39) *124W probably null Het
Gm7535 T A 17: 18,131,333 (GRCm39) probably benign Het
H4c1 T C 13: 23,944,935 (GRCm39) D69G probably damaging Het
Herc3 T C 6: 58,864,484 (GRCm39) V706A probably damaging Het
Hivep3 A G 4: 119,980,131 (GRCm39) E1723G probably damaging Het
Igsf9b A G 9: 27,233,946 (GRCm39) I382V probably benign Het
Ints1 G T 5: 139,756,911 (GRCm39) T467N possibly damaging Het
Iqca1 G A 1: 89,973,423 (GRCm39) T783M probably damaging Het
Kng1 A G 16: 22,886,448 (GRCm39) K131R possibly damaging Het
Krt35 T C 11: 99,983,956 (GRCm39) Y348C probably damaging Het
Ldlrad3 A G 2: 101,943,881 (GRCm39) C64R probably damaging Het
Lilrb4b C T 10: 51,360,616 (GRCm39) A272V possibly damaging Het
Lrrc37 T C 11: 103,505,698 (GRCm39) H2090R probably benign Het
Ltn1 A T 16: 87,195,697 (GRCm39) C1276* probably null Het
Matn1 G A 4: 130,679,425 (GRCm39) A360T probably benign Het
Minpp1 G A 19: 32,475,784 (GRCm39) V306I probably benign Het
Mkx G A 18: 6,992,904 (GRCm39) R127W probably damaging Het
Mrpl48 G T 7: 100,195,616 (GRCm39) probably benign Het
Ms4a2 A G 19: 11,595,793 (GRCm39) L166S possibly damaging Het
Mtus2 T A 5: 148,013,913 (GRCm39) Y235* probably null Het
Myh4 G T 11: 67,131,880 (GRCm39) W113C probably damaging Het
Nav2 T A 7: 49,198,182 (GRCm39) C1270* probably null Het
Ncoa5 A G 2: 164,844,070 (GRCm39) L111P probably damaging Het
Nup107 T C 10: 117,606,383 (GRCm39) Y453C probably damaging Het
Oca2 C T 7: 55,980,106 (GRCm39) Q604* probably null Het
Or13a19 T C 7: 139,903,014 (GRCm39) M134T probably benign Het
Or13p5 A C 4: 118,591,885 (GRCm39) H53P probably benign Het
Or14j10 A T 17: 37,934,782 (GRCm39) V248D probably damaging Het
Or5p58 T A 7: 107,694,303 (GRCm39) N158I probably benign Het
Or8g33 T C 9: 39,337,531 (GRCm39) T279A possibly damaging Het
Pde3a G T 6: 141,416,668 (GRCm39) G514V possibly damaging Het
Pik3cb A T 9: 98,983,381 (GRCm39) C76S probably damaging Het
Plk1 T C 7: 121,767,828 (GRCm39) V411A probably damaging Het
Pole C T 5: 110,472,619 (GRCm39) P1600L probably damaging Het
Prr36 T C 8: 4,260,881 (GRCm39) T979A probably benign Het
Rdh7 T A 10: 127,721,590 (GRCm39) T229S probably benign Het
Rnpepl1 A T 1: 92,842,835 (GRCm39) T140S probably damaging Het
Rps6kc1 A T 1: 190,530,891 (GRCm39) S947T probably benign Het
Rtl1 A G 12: 109,558,138 (GRCm39) F1234L probably damaging Het
Sdc1 G A 12: 8,841,708 (GRCm39) M279I probably damaging Het
Siae T C 9: 37,539,096 (GRCm39) L169P possibly damaging Het
Slc22a22 C T 15: 57,113,148 (GRCm39) V364I probably benign Het
Sltm G T 9: 70,496,260 (GRCm39) V932F probably damaging Het
Smad1 A G 8: 80,076,381 (GRCm39) L279P probably damaging Het
Spag17 G T 3: 99,958,147 (GRCm39) G935V probably damaging Het
Srgap3 A G 6: 112,723,895 (GRCm39) S546P probably damaging Het
Stxbp5 T C 10: 9,684,844 (GRCm39) I519V probably benign Het
Syt16 A T 12: 74,176,160 (GRCm39) I10F probably damaging Het
Trim43b C G 9: 88,973,365 (GRCm39) G123R probably damaging Het
Ubr3 T C 2: 69,843,475 (GRCm39) Y1572H probably damaging Het
Umodl1 G A 17: 31,227,639 (GRCm39) R1324H probably benign Het
Vmn2r44 A T 7: 8,380,985 (GRCm39) W303R probably benign Het
Wdr93 T C 7: 79,435,522 (GRCm39) Y684H probably damaging Het
Wnk2 G A 13: 49,224,478 (GRCm39) R268C probably damaging Het
Zfp438 C T 18: 5,213,776 (GRCm39) C394Y possibly damaging Het
Other mutations in Cacna1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cacna1h APN 17 25,600,482 (GRCm39) missense probably damaging 1.00
IGL01412:Cacna1h APN 17 25,610,924 (GRCm39) missense probably benign 0.24
IGL01625:Cacna1h APN 17 25,604,686 (GRCm39) missense possibly damaging 0.95
IGL01625:Cacna1h APN 17 25,602,459 (GRCm39) missense probably damaging 0.97
IGL01684:Cacna1h APN 17 25,607,690 (GRCm39) missense probably damaging 1.00
IGL01862:Cacna1h APN 17 25,602,457 (GRCm39) missense probably damaging 1.00
IGL01877:Cacna1h APN 17 25,607,024 (GRCm39) missense probably damaging 1.00
IGL02040:Cacna1h APN 17 25,616,585 (GRCm39) missense probably benign 0.10
IGL02190:Cacna1h APN 17 25,652,000 (GRCm39) missense probably benign
IGL02686:Cacna1h APN 17 25,604,723 (GRCm39) missense possibly damaging 0.80
IGL02883:Cacna1h APN 17 25,599,506 (GRCm39) missense probably damaging 1.00
IGL02945:Cacna1h APN 17 25,607,033 (GRCm39) missense probably damaging 1.00
IGL03025:Cacna1h APN 17 25,651,868 (GRCm39) nonsense probably null
IGL03095:Cacna1h APN 17 25,602,752 (GRCm39) unclassified probably benign
IGL03207:Cacna1h APN 17 25,610,307 (GRCm39) missense probably damaging 1.00
IGL02991:Cacna1h UTSW 17 25,610,286 (GRCm39) missense possibly damaging 0.56
IGL03097:Cacna1h UTSW 17 25,610,118 (GRCm39) missense probably damaging 1.00
R0010:Cacna1h UTSW 17 25,599,818 (GRCm39) missense probably damaging 1.00
R0194:Cacna1h UTSW 17 25,599,898 (GRCm39) unclassified probably benign
R0361:Cacna1h UTSW 17 25,608,396 (GRCm39) missense probably damaging 1.00
R0501:Cacna1h UTSW 17 25,607,641 (GRCm39) missense probably damaging 1.00
R0558:Cacna1h UTSW 17 25,600,524 (GRCm39) missense probably damaging 1.00
R0588:Cacna1h UTSW 17 25,606,538 (GRCm39) missense probably damaging 1.00
R0626:Cacna1h UTSW 17 25,612,520 (GRCm39) missense possibly damaging 0.92
R0811:Cacna1h UTSW 17 25,607,602 (GRCm39) missense probably damaging 1.00
R0812:Cacna1h UTSW 17 25,607,602 (GRCm39) missense probably damaging 1.00
R0964:Cacna1h UTSW 17 25,597,749 (GRCm39) unclassified probably benign
R1351:Cacna1h UTSW 17 25,610,925 (GRCm39) missense probably benign 0.14
R1457:Cacna1h UTSW 17 25,616,594 (GRCm39) missense probably damaging 1.00
R1521:Cacna1h UTSW 17 25,616,328 (GRCm39) missense possibly damaging 0.57
R1564:Cacna1h UTSW 17 25,596,835 (GRCm39) nonsense probably null
R1611:Cacna1h UTSW 17 25,600,445 (GRCm39) missense probably damaging 1.00
R1669:Cacna1h UTSW 17 25,602,445 (GRCm39) missense probably damaging 1.00
R1835:Cacna1h UTSW 17 25,611,050 (GRCm39) missense probably benign 0.01
R1858:Cacna1h UTSW 17 25,599,781 (GRCm39) missense probably damaging 1.00
R1887:Cacna1h UTSW 17 25,595,861 (GRCm39) missense probably benign 0.01
R2039:Cacna1h UTSW 17 25,610,819 (GRCm39) missense probably benign 0.03
R2091:Cacna1h UTSW 17 25,651,850 (GRCm39) missense possibly damaging 0.95
R2133:Cacna1h UTSW 17 25,602,502 (GRCm39) missense probably damaging 1.00
R2203:Cacna1h UTSW 17 25,599,234 (GRCm39) missense probably damaging 1.00
R2205:Cacna1h UTSW 17 25,599,234 (GRCm39) missense probably damaging 1.00
R2206:Cacna1h UTSW 17 25,603,987 (GRCm39) missense probably benign 0.10
R2207:Cacna1h UTSW 17 25,603,987 (GRCm39) missense probably benign 0.10
R2224:Cacna1h UTSW 17 25,604,917 (GRCm39) missense probably benign 0.03
R2226:Cacna1h UTSW 17 25,604,917 (GRCm39) missense probably benign 0.03
R2261:Cacna1h UTSW 17 25,652,139 (GRCm39) missense possibly damaging 0.91
R2361:Cacna1h UTSW 17 25,602,986 (GRCm39) missense probably damaging 1.00
R2917:Cacna1h UTSW 17 25,614,426 (GRCm39) missense probably damaging 0.97
R3031:Cacna1h UTSW 17 25,652,108 (GRCm39) missense probably damaging 0.99
R3856:Cacna1h UTSW 17 25,611,427 (GRCm39) missense probably damaging 1.00
R4230:Cacna1h UTSW 17 25,606,837 (GRCm39) missense probably damaging 1.00
R4408:Cacna1h UTSW 17 25,599,601 (GRCm39) missense probably damaging 1.00
R4687:Cacna1h UTSW 17 25,612,884 (GRCm39) missense possibly damaging 0.47
R4895:Cacna1h UTSW 17 25,608,396 (GRCm39) missense probably damaging 0.99
R5067:Cacna1h UTSW 17 25,616,782 (GRCm39) missense probably damaging 1.00
R5077:Cacna1h UTSW 17 25,594,224 (GRCm39) missense probably benign 0.02
R5148:Cacna1h UTSW 17 25,606,519 (GRCm39) missense probably damaging 1.00
R5336:Cacna1h UTSW 17 25,611,205 (GRCm39) missense probably damaging 0.99
R5450:Cacna1h UTSW 17 25,602,160 (GRCm39) missense probably damaging 1.00
R5616:Cacna1h UTSW 17 25,596,641 (GRCm39) missense probably damaging 1.00
R5738:Cacna1h UTSW 17 25,606,023 (GRCm39) missense probably damaging 0.99
R5883:Cacna1h UTSW 17 25,595,896 (GRCm39) missense probably benign 0.00
R5954:Cacna1h UTSW 17 25,602,175 (GRCm39) missense probably damaging 1.00
R5961:Cacna1h UTSW 17 25,596,246 (GRCm39) missense probably benign 0.01
R6110:Cacna1h UTSW 17 25,610,250 (GRCm39) missense probably benign 0.10
R6125:Cacna1h UTSW 17 25,604,668 (GRCm39) missense probably benign 0.00
R6189:Cacna1h UTSW 17 25,616,818 (GRCm39) missense probably damaging 1.00
R6216:Cacna1h UTSW 17 25,597,793 (GRCm39) missense probably damaging 1.00
R6259:Cacna1h UTSW 17 25,616,630 (GRCm39) critical splice acceptor site probably null
R6296:Cacna1h UTSW 17 25,602,053 (GRCm39) missense probably damaging 1.00
R6394:Cacna1h UTSW 17 25,606,455 (GRCm39) missense probably benign 0.32
R6695:Cacna1h UTSW 17 25,612,714 (GRCm39) missense probably damaging 1.00
R6746:Cacna1h UTSW 17 25,600,524 (GRCm39) missense probably damaging 1.00
R6914:Cacna1h UTSW 17 25,604,013 (GRCm39) missense probably benign
R6942:Cacna1h UTSW 17 25,604,013 (GRCm39) missense probably benign
R6955:Cacna1h UTSW 17 25,607,030 (GRCm39) missense probably damaging 1.00
R7041:Cacna1h UTSW 17 25,612,977 (GRCm39) missense probably damaging 0.98
R7120:Cacna1h UTSW 17 25,610,481 (GRCm39) missense probably benign 0.31
R7125:Cacna1h UTSW 17 25,602,510 (GRCm39) missense probably damaging 0.99
R7182:Cacna1h UTSW 17 25,596,629 (GRCm39) missense probably damaging 1.00
R7270:Cacna1h UTSW 17 25,603,739 (GRCm39) missense probably damaging 1.00
R7274:Cacna1h UTSW 17 25,597,811 (GRCm39) missense probably damaging 1.00
R7319:Cacna1h UTSW 17 25,608,435 (GRCm39) missense possibly damaging 0.94
R7406:Cacna1h UTSW 17 25,604,600 (GRCm39) missense possibly damaging 0.56
R7634:Cacna1h UTSW 17 25,611,083 (GRCm39) missense possibly damaging 0.87
R7684:Cacna1h UTSW 17 25,608,346 (GRCm39) missense probably damaging 0.99
R7769:Cacna1h UTSW 17 25,604,779 (GRCm39) missense probably damaging 1.00
R7856:Cacna1h UTSW 17 25,608,451 (GRCm39) missense probably damaging 0.98
R7876:Cacna1h UTSW 17 25,594,225 (GRCm39) missense probably benign
R7898:Cacna1h UTSW 17 25,611,250 (GRCm39) missense probably damaging 1.00
R8038:Cacna1h UTSW 17 25,594,865 (GRCm39) missense probably damaging 0.97
R8042:Cacna1h UTSW 17 25,611,445 (GRCm39) nonsense probably null
R8139:Cacna1h UTSW 17 25,602,697 (GRCm39) missense probably damaging 1.00
R8391:Cacna1h UTSW 17 25,596,204 (GRCm39) missense probably benign 0.00
R8795:Cacna1h UTSW 17 25,612,538 (GRCm39) missense probably damaging 1.00
R9227:Cacna1h UTSW 17 25,599,856 (GRCm39) missense probably damaging 1.00
R9230:Cacna1h UTSW 17 25,599,856 (GRCm39) missense probably damaging 1.00
R9236:Cacna1h UTSW 17 25,600,424 (GRCm39) missense probably damaging 1.00
R9360:Cacna1h UTSW 17 25,594,336 (GRCm39) missense probably benign 0.00
R9476:Cacna1h UTSW 17 25,611,524 (GRCm39) missense probably damaging 1.00
R9567:Cacna1h UTSW 17 25,612,487 (GRCm39) missense probably damaging 1.00
R9696:Cacna1h UTSW 17 25,602,215 (GRCm39) missense possibly damaging 0.90
V1662:Cacna1h UTSW 17 25,596,283 (GRCm39) missense possibly damaging 0.68
Z1176:Cacna1h UTSW 17 25,610,224 (GRCm39) missense probably benign
Z1177:Cacna1h UTSW 17 25,612,558 (GRCm39) missense probably benign 0.15
Z1177:Cacna1h UTSW 17 25,610,352 (GRCm39) missense probably damaging 0.99
Z1177:Cacna1h UTSW 17 25,594,866 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGAACTGTGTGGCCTGAG -3'
(R):5'- TCATGAAGCACCTGGAGGAG -3'

Sequencing Primer
(F):5'- GCCACGCTGCCCAATTTC -3'
(R):5'- CCGAGATCGAGCTGGAGATC -3'
Posted On 2016-03-17