Incidental Mutation 'R4888:Unc80'
ID377031
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Nameunc-80, NALCN activator
SynonymsC030018G13Rik, C230061B10Rik
MMRRC Submission 042493-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.883) question?
Stock #R4888 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location66468367-66699148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 66644447 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 2216 (P2216Q)
Ref Sequence ENSEMBL: ENSMUSP00000053692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
Predicted Effect probably damaging
Transcript: ENSMUST00000061620
AA Change: P2216Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: P2216Q

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212557
AA Change: P2148Q
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (150/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931403M11Rik C A 14: 24,621,351 noncoding transcript Het
4931408C20Rik A G 1: 26,683,547 Y851H probably benign Het
Abca7 A G 10: 80,002,728 K612R probably damaging Het
Adamtsl3 T C 7: 82,574,614 V275A possibly damaging Het
Afg3l1 G A 8: 123,488,326 probably null Het
Alcam T A 16: 52,268,813 H508L probably benign Het
Ankrd45 G A 1: 161,155,372 R151H probably damaging Het
Aqr G A 2: 114,150,509 L264F probably damaging Het
Arfgef2 G A 2: 166,835,613 A53T probably damaging Het
Arhgap30 A G 1: 171,409,312 T1085A probably benign Het
Atp10a T C 7: 58,785,307 V314A probably damaging Het
Bdp1 T C 13: 100,051,119 D1580G probably benign Het
Btbd17 T A 11: 114,794,091 T41S possibly damaging Het
Cacna1c T C 6: 118,751,439 N378S probably damaging Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Ccar1 A G 10: 62,753,218 S829P unknown Het
Ccdc180 T C 4: 45,909,308 L492P probably damaging Het
Ccser2 A T 14: 36,940,386 N280K probably damaging Het
Cd37 T C 7: 45,233,935 D271G probably damaging Het
Cdcp1 G A 9: 123,182,129 probably benign Het
Cep85 T A 4: 134,164,751 probably benign Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Csmd1 A G 8: 15,895,674 probably benign Het
Cytl1 G T 5: 37,735,574 L9F unknown Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Degs1 G A 1: 182,276,805 T305I probably damaging Het
Dnttip2 T G 3: 122,276,592 C485W probably damaging Het
Ecel1 G A 1: 87,148,727 probably benign Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Elmo2 A T 2: 165,295,289 C562S probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
F2r A C 13: 95,604,397 V210G probably damaging Het
Fam171a1 T A 2: 3,223,509 V179E probably damaging Het
Fmod G T 1: 134,040,239 V6F possibly damaging Het
Foxr2 A G X: 153,130,316 Q61R probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gck A T 11: 5,909,150 M139K possibly damaging Het
Gif A G 19: 11,752,219 T181A probably benign Het
Gm10192 C G 4: 97,183,108 S20T probably null Het
Gm13088 A G 4: 143,654,401 S351P probably benign Het
Gm44501 T C 17: 40,576,624 L11P unknown Het
Gm572 T C 4: 148,666,845 probably null Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Gnas A G 2: 174,298,089 K17R possibly damaging Het
Grm2 T A 9: 106,650,666 S340C probably damaging Het
Gsc T A 12: 104,472,015 H198L probably damaging Het
H2-Q3 A T 17: 35,359,448 noncoding transcript Het
Hist1h4a T C 13: 23,760,952 D69G probably damaging Het
Hivep3 A G 4: 120,122,934 E1723G probably damaging Het
Hk3 A T 13: 55,006,592 L757Q probably damaging Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Ier3ip1 T A 18: 76,939,531 probably benign Het
Itch T A 2: 155,217,977 probably null Het
Kalrn T A 16: 34,171,330 Q974L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Klhl9 T C 4: 88,721,945 K20E probably benign Het
Kmt2a G T 9: 44,821,680 probably benign Het
Krt17 C A 11: 100,256,479 V409L probably benign Het
Lmx1b T C 2: 33,564,790 N322S probably benign Het
Lrrc63 G C 14: 75,125,966 P242A probably benign Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Map3k19 T A 1: 127,817,733 E1328V probably damaging Het
Map4k2 C T 19: 6,344,003 A280V probably benign Het
Mettl11b A T 1: 163,703,064 C269S probably benign Het
Micall1 C T 15: 79,131,848 R802* probably null Het
Mmp14 A G 14: 54,436,205 R109G probably damaging Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mpeg1 A G 19: 12,463,070 T631A probably damaging Het
Mpnd A G 17: 56,011,641 M217V probably benign Het
Mrc2 T C 11: 105,341,208 V862A probably damaging Het
Mug2 T A 6: 122,081,195 S1239T probably damaging Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo18b A T 5: 112,874,480 probably benign Het
Myo1c C A 11: 75,669,227 T703N probably damaging Het
Myt1l T G 12: 29,886,139 C909G unknown Het
Nbea T C 3: 56,005,355 S1004G possibly damaging Het
Neb T C 2: 52,296,307 N918D probably benign Het
Nrtn T C 17: 56,751,636 T122A probably damaging Het
Nsd3 A T 8: 25,698,911 S1042C probably damaging Het
Nvl A G 1: 181,117,626 L461S probably damaging Het
Olfr1339 A C 4: 118,734,688 H53P probably benign Het
Olfr1346 A T 7: 6,474,613 I168F probably damaging Het
Olfr1425 C G 19: 12,074,315 G106R probably damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr786 A C 10: 129,437,379 D189A possibly damaging Het
Olfr90 G A 17: 37,085,451 T238I probably damaging Het
Onecut2 A T 18: 64,340,927 H183L possibly damaging Het
Pcdhb21 G T 18: 37,515,077 V420F possibly damaging Het
Pcdhb9 G A 18: 37,403,233 G760D probably benign Het
Pglyrp2 G A 17: 32,418,797 P86S probably benign Het
Phyhip T A 14: 70,467,325 V328E probably damaging Het
Pitpnb A T 5: 111,382,996 K218N possibly damaging Het
Pitrm1 A G 13: 6,578,560 D963G probably damaging Het
Pmfbp1 A G 8: 109,532,160 Y699C probably damaging Het
Pmpcb T A 5: 21,740,662 probably benign Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Prss41 A T 17: 23,837,003 M252K probably benign Het
Prss46 A T 9: 110,844,550 M1L possibly damaging Het
Rimklb T C 6: 122,464,092 probably null Het
Rngtt T C 4: 33,500,335 I556T unknown Het
Rock1 A C 18: 10,122,698 D374E probably benign Het
Rspry1 C A 8: 94,658,789 H450N probably benign Het
Rusc2 T C 4: 43,423,942 V1032A probably damaging Het
Sacs A G 14: 61,212,198 R3898G probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Sipa1l1 C A 12: 82,342,333 S444R probably damaging Het
Sntg1 T A 1: 8,363,594 I478F probably damaging Het
Sptb G T 12: 76,609,037 L1424M probably benign Het
Sry T A Y: 2,663,105 H185L unknown Het
Stox2 T G 8: 47,203,163 T93P probably damaging Het
Tatdn2 T A 6: 113,704,605 F472Y possibly damaging Het
Tefm A T 11: 80,140,359 V17D possibly damaging Het
Tekt2 G T 4: 126,324,667 T70N probably benign Het
Ticam1 T C 17: 56,271,642 D151G probably damaging Het
Tmem2 T C 19: 21,856,164 V1322A probably benign Het
Tmem63c A G 12: 87,089,365 E785G probably damaging Het
Tnmd A T X: 133,864,802 N219I probably benign Het
Ttc14 T A 3: 33,806,875 L407* probably null Het
Ttll7 T C 3: 146,894,177 M1T probably null Het
Ttn T A 2: 76,916,491 probably null Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Uggt2 T C 14: 119,049,253 T224A probably damaging Het
Uggt2 A T 14: 119,077,650 probably null Het
Umodl1 A G 17: 30,999,201 E1254G probably damaging Het
Unc5d A G 8: 28,666,899 F773L probably benign Het
Usp40 T A 1: 87,986,201 probably null Het
Vmn1r117 A T 7: 20,883,496 M209K probably damaging Het
Vmn2r44 A T 7: 8,377,986 W303R probably benign Het
Wnk2 G A 13: 49,071,002 R268C probably damaging Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Xkr6 T C 14: 63,819,504 V288A unknown Het
Zfp125 A G 12: 20,900,458 noncoding transcript Het
Zfp512b A C 2: 181,587,063 V703G probably damaging Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zgpat T C 2: 181,378,858 S275P probably benign Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66654395 missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66606459 missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00784:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00935:Unc80 APN 1 66627266 missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66695433 missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66622486 missense probably benign 0.33
IGL01577:Unc80 APN 1 66529968 splice site probably null
IGL01626:Unc80 APN 1 66551054 critical splice donor site probably null
IGL01640:Unc80 APN 1 66679585 missense probably benign 0.33
IGL01775:Unc80 APN 1 66601056 missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66608500 splice site probably benign
IGL01991:Unc80 APN 1 66469509 nonsense probably null
IGL02022:Unc80 APN 1 66626516 missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66612227 missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66525716 missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66530065 missense probably benign 0.39
IGL02198:Unc80 APN 1 66529986 missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66608428 missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66641673 missense probably benign 0.33
IGL02447:Unc80 APN 1 66503544 missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66525701 missense probably benign 0.07
IGL02546:Unc80 APN 1 66554953 missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66483317 missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66530063 missense probably damaging 0.98
IGL02839:Unc80 APN 1 66671675 missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66678058 splice site probably benign
IGL02974:Unc80 APN 1 66525658 missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66637010 missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66509489 missense probably damaging 0.96
IGL03074:Unc80 APN 1 66671718 splice site probably benign
IGL03086:Unc80 APN 1 66509474 missense probably damaging 0.99
IGL03105:Unc80 APN 1 66472099 missense probably damaging 0.96
IGL03107:Unc80 APN 1 66631454 missense probably damaging 0.98
IGL03158:Unc80 APN 1 66641674 missense probably benign 0.33
IGL03220:Unc80 APN 1 66504938 missense probably damaging 0.99
IGL03271:Unc80 APN 1 66695603 unclassified probably benign
IGL03332:Unc80 APN 1 66503631 missense probably damaging 1.00
IGL03347:Unc80 APN 1 66695466 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0026:Unc80 UTSW 1 66521584 missense probably benign 0.27
R0055:Unc80 UTSW 1 66506623 splice site probably benign
R0149:Unc80 UTSW 1 66521601 missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66510881 missense probably damaging 1.00
R0329:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66549856 missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66550937 splice site probably benign
R0422:Unc80 UTSW 1 66483338 missense probably damaging 1.00
R0477:Unc80 UTSW 1 66570001 missense probably damaging 0.99
R0507:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66622474 missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66506669 missense probably damaging 0.97
R0626:Unc80 UTSW 1 66608442 missense probably benign 0.01
R0655:Unc80 UTSW 1 66503781 missense probably damaging 0.98
R0742:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66504923 missense probably damaging 1.00
R0782:Unc80 UTSW 1 66622581 missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66648944 missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R0893:Unc80 UTSW 1 66521486 missense probably damaging 0.97
R0900:Unc80 UTSW 1 66671598 missense probably benign 0.33
R0924:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66646440 missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1224:Unc80 UTSW 1 66471980 missense probably damaging 1.00
R1240:Unc80 UTSW 1 66635902 missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66555095 missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66637957 missense probably damaging 1.00
R1655:Unc80 UTSW 1 66672756 missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66509308 missense probably damaging 1.00
R1680:Unc80 UTSW 1 66503669 nonsense probably null
R1739:Unc80 UTSW 1 66527892 missense probably damaging 0.97
R1756:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66683273 missense probably benign 0.01
R1834:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66631414 missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66510717 missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66509402 missense probably damaging 0.96
R1883:Unc80 UTSW 1 66525770 missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66510625 missense probably damaging 1.00
R1990:Unc80 UTSW 1 66692549 missense probably damaging 0.97
R2007:Unc80 UTSW 1 66503776 missense probably damaging 1.00
R2035:Unc80 UTSW 1 66606593 missense probably damaging 0.98
R2056:Unc80 UTSW 1 66640552 missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66640595 missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66679744 critical splice donor site probably null
R2088:Unc80 UTSW 1 66590227 missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66671715 splice site probably benign
R2091:Unc80 UTSW 1 66671715 splice site probably benign
R2139:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66677355 missense probably damaging 1.00
R2248:Unc80 UTSW 1 66623206 splice site probably benign
R2255:Unc80 UTSW 1 66618258 missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66648997 missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66612107 missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66671608 missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66671576 critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3104:Unc80 UTSW 1 66623291 missense probably benign 0.33
R3402:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3403:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3413:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3426:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3427:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3428:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3904:Unc80 UTSW 1 66639296 nonsense probably null
R3916:Unc80 UTSW 1 66677495 missense probably benign 0.11
R3950:Unc80 UTSW 1 66622570 missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66671714 splice site probably null
R4646:Unc80 UTSW 1 66669235 missense probably benign 0.03
R4655:Unc80 UTSW 1 66671662 missense probably benign 0.18
R4662:Unc80 UTSW 1 66646436 missense probably benign 0.01
R4720:Unc80 UTSW 1 66510792 missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66649672 critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66527941 missense probably damaging 0.97
R4917:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66674732 intron probably null
R5051:Unc80 UTSW 1 66509477 missense probably damaging 0.96
R5111:Unc80 UTSW 1 66527995 missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66679590 missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66646587 missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66606513 missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66530021 missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66654578 missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66606614 missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66638043 missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66640572 missense probably benign 0.08
R5762:Unc80 UTSW 1 66693796 missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66527964 missense probably damaging 0.97
R6005:Unc80 UTSW 1 66627257 missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66695568 missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66675067 missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66612250 missense probably benign 0.01
R6157:Unc80 UTSW 1 66654029 nonsense probably null
R6189:Unc80 UTSW 1 66677471 missense probably benign 0.33
R6291:Unc80 UTSW 1 66521597 missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66672766 missense probably benign 0.33
R6598:Unc80 UTSW 1 66468540 critical splice donor site probably null
R6724:Unc80 UTSW 1 66683191 missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66521477 missense probably benign 0.00
R6773:Unc80 UTSW 1 66651543 missense probably benign 0.33
R6883:Unc80 UTSW 1 66646404 missense probably benign 0.33
R6951:Unc80 UTSW 1 66648511 missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66646566 missense probably benign 0.33
R6993:Unc80 UTSW 1 66549793 missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66503593 missense probably benign 0.00
R7050:Unc80 UTSW 1 66550908 intron probably null
R7067:Unc80 UTSW 1 66646572 missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66646521 missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66549784 missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66521566 nonsense probably null
R7278:Unc80 UTSW 1 66552209 missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66601197 missense probably damaging 0.97
R7391:Unc80 UTSW 1 66695528 missense probably benign 0.18
R7401:Unc80 UTSW 1 66646415 missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66622462 missense probably benign 0.02
R7573:Unc80 UTSW 1 66521537 missense probably damaging 1.00
R7637:Unc80 UTSW 1 66672684 missense possibly damaging 0.86
R7678:Unc80 UTSW 1 66649722 missense probably benign 0.33
R7697:Unc80 UTSW 1 66637945 missense possibly damaging 0.93
R7746:Unc80 UTSW 1 66677385 missense probably benign 0.33
R7768:Unc80 UTSW 1 66510595 missense possibly damaging 0.56
R7796:Unc80 UTSW 1 66503714 missense probably benign
X0019:Unc80 UTSW 1 66648382 missense probably benign 0.33
X0021:Unc80 UTSW 1 66509266 critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66491046 missense probably benign 0.21
X0062:Unc80 UTSW 1 66623259 missense probably benign 0.02
X0066:Unc80 UTSW 1 66530757 missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66646451 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AACTCAGCTCTCTGACTGCG -3'
(R):5'- AACTTCTTCCCAGCCCAGAG -3'

Sequencing Primer
(F):5'- CTTCAGGTGTTCACCCGGAAG -3'
(R):5'- AGCCCAGAGTCAGCTACTGTTC -3'
Posted On2016-03-17