Incidental Mutation 'R4888:Gnas'
ID377056
Institutional Source Beutler Lab
Gene Symbol Gnas
Ensembl Gene ENSMUSG00000027523
Gene NameGNAS (guanine nucleotide binding protein, alpha stimulating) complex locus
SynonymsGnasxl, C130027O20Rik, 5530400H20Rik, Nespl, Nesp, A930027G11Rik, Gs alpha, G alpha s, Gsa, Nesp55, Galphas, Gnas1, P1, Gs-alpha, XLalphas, P3, neuroendocrine-specific Golgi protein p55 isoform 1, Oedsml, P2
MMRRC Submission 042493-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4888 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location174284320-174346744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174298089 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 17 (K17R)
Ref Sequence ENSEMBL: ENSMUSP00000139839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080493] [ENSMUST00000087876] [ENSMUST00000087877] [ENSMUST00000109088] [ENSMUST00000109095] [ENSMUST00000109096] [ENSMUST00000130761] [ENSMUST00000130940] [ENSMUST00000180362] [ENSMUST00000185956] [ENSMUST00000186907]
Predicted Effect silent
Transcript: ENSMUST00000080493
SMART Domains Protein: ENSMUSP00000079341
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 3.02e-8 PROSPERO
internal_repeat_1 209 276 3.02e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1132 5.01e-185 SMART
Predicted Effect silent
Transcript: ENSMUST00000087876
SMART Domains Protein: ENSMUSP00000085184
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 2.42e-8 PROSPERO
internal_repeat_1 209 276 2.42e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1118 8.32e-191 SMART
Predicted Effect silent
Transcript: ENSMUST00000087877
SMART Domains Protein: ENSMUSP00000085185
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 1.1e-8 PROSPERO
internal_repeat_1 209 276 1.1e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
Blast:G_alpha 759 799 2e-14 BLAST
low complexity region 802 816 N/A INTRINSIC
low complexity region 847 859 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109088
AA Change: K17R

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104716
Gene: ENSMUSG00000027523
AA Change: K17R

DomainStartEndE-ValueType
low complexity region 192 209 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
low complexity region 421 446 N/A INTRINSIC
low complexity region 459 481 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
low complexity region 529 599 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
low complexity region 700 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109095
SMART Domains Protein: ENSMUSP00000104723
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109096
SMART Domains Protein: ENSMUSP00000104724
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130761
Predicted Effect probably benign
Transcript: ENSMUST00000130940
SMART Domains Protein: ENSMUSP00000118210
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 59 1.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154658
Predicted Effect probably benign
Transcript: ENSMUST00000180362
SMART Domains Protein: ENSMUSP00000136180
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184327
Predicted Effect silent
Transcript: ENSMUST00000185956
SMART Domains Protein: ENSMUSP00000140174
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 3.02e-8 PROSPERO
internal_repeat_1 209 276 3.02e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1132 5.01e-185 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186907
AA Change: K17R

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139839
Gene: ENSMUSG00000027523
AA Change: K17R

DomainStartEndE-ValueType
low complexity region 192 209 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
low complexity region 421 446 N/A INTRINSIC
low complexity region 459 481 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
low complexity region 529 599 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
low complexity region 700 716 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (150/151)
MGI Phenotype FUNCTION: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, which is commonly found in imprinted genes and correlates with transcript expression. This gene has an antisense transcript. One of the transcripts produced from this locus, and the antisense transcript, are both paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Additional transcript variants have been found for this gene, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mutant homozygotes stop developing normally by embryonic day 10.5 and die prenatally. On some backgrounds heterozygotes show imprinted phenotypes, including differences in body shape/weight, locomotor activity, metabolism, and developmental anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931403M11Rik C A 14: 24,621,351 noncoding transcript Het
4931408C20Rik A G 1: 26,683,547 Y851H probably benign Het
Abca7 A G 10: 80,002,728 K612R probably damaging Het
Adamtsl3 T C 7: 82,574,614 V275A possibly damaging Het
Afg3l1 G A 8: 123,488,326 probably null Het
Alcam T A 16: 52,268,813 H508L probably benign Het
Ankrd45 G A 1: 161,155,372 R151H probably damaging Het
Aqr G A 2: 114,150,509 L264F probably damaging Het
Arfgef2 G A 2: 166,835,613 A53T probably damaging Het
Arhgap30 A G 1: 171,409,312 T1085A probably benign Het
Atp10a T C 7: 58,785,307 V314A probably damaging Het
Bdp1 T C 13: 100,051,119 D1580G probably benign Het
Btbd17 T A 11: 114,794,091 T41S possibly damaging Het
Cacna1c T C 6: 118,751,439 N378S probably damaging Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Ccar1 A G 10: 62,753,218 S829P unknown Het
Ccdc180 T C 4: 45,909,308 L492P probably damaging Het
Ccser2 A T 14: 36,940,386 N280K probably damaging Het
Cd37 T C 7: 45,233,935 D271G probably damaging Het
Cdcp1 G A 9: 123,182,129 probably benign Het
Cep85 T A 4: 134,164,751 probably benign Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Csmd1 A G 8: 15,895,674 probably benign Het
Cytl1 G T 5: 37,735,574 L9F unknown Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Degs1 G A 1: 182,276,805 T305I probably damaging Het
Dnttip2 T G 3: 122,276,592 C485W probably damaging Het
Ecel1 G A 1: 87,148,727 probably benign Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Elmo2 A T 2: 165,295,289 C562S probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
F2r A C 13: 95,604,397 V210G probably damaging Het
Fam171a1 T A 2: 3,223,509 V179E probably damaging Het
Fmod G T 1: 134,040,239 V6F possibly damaging Het
Foxr2 A G X: 153,130,316 Q61R probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gck A T 11: 5,909,150 M139K possibly damaging Het
Gif A G 19: 11,752,219 T181A probably benign Het
Gm10192 C G 4: 97,183,108 S20T probably null Het
Gm13088 A G 4: 143,654,401 S351P probably benign Het
Gm44501 T C 17: 40,576,624 L11P unknown Het
Gm572 T C 4: 148,666,845 probably null Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Grm2 T A 9: 106,650,666 S340C probably damaging Het
Gsc T A 12: 104,472,015 H198L probably damaging Het
H2-Q3 A T 17: 35,359,448 noncoding transcript Het
Hist1h4a T C 13: 23,760,952 D69G probably damaging Het
Hivep3 A G 4: 120,122,934 E1723G probably damaging Het
Hk3 A T 13: 55,006,592 L757Q probably damaging Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Ier3ip1 T A 18: 76,939,531 probably benign Het
Itch T A 2: 155,217,977 probably null Het
Kalrn T A 16: 34,171,330 Q974L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Klhl9 T C 4: 88,721,945 K20E probably benign Het
Kmt2a G T 9: 44,821,680 probably benign Het
Krt17 C A 11: 100,256,479 V409L probably benign Het
Lmx1b T C 2: 33,564,790 N322S probably benign Het
Lrrc63 G C 14: 75,125,966 P242A probably benign Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Map3k19 T A 1: 127,817,733 E1328V probably damaging Het
Map4k2 C T 19: 6,344,003 A280V probably benign Het
Mettl11b A T 1: 163,703,064 C269S probably benign Het
Micall1 C T 15: 79,131,848 R802* probably null Het
Mmp14 A G 14: 54,436,205 R109G probably damaging Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mpeg1 A G 19: 12,463,070 T631A probably damaging Het
Mpnd A G 17: 56,011,641 M217V probably benign Het
Mrc2 T C 11: 105,341,208 V862A probably damaging Het
Mug2 T A 6: 122,081,195 S1239T probably damaging Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo18b A T 5: 112,874,480 probably benign Het
Myo1c C A 11: 75,669,227 T703N probably damaging Het
Myt1l T G 12: 29,886,139 C909G unknown Het
Nbea T C 3: 56,005,355 S1004G possibly damaging Het
Neb T C 2: 52,296,307 N918D probably benign Het
Nrtn T C 17: 56,751,636 T122A probably damaging Het
Nsd3 A T 8: 25,698,911 S1042C probably damaging Het
Nvl A G 1: 181,117,626 L461S probably damaging Het
Olfr1339 A C 4: 118,734,688 H53P probably benign Het
Olfr1346 A T 7: 6,474,613 I168F probably damaging Het
Olfr1425 C G 19: 12,074,315 G106R probably damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr786 A C 10: 129,437,379 D189A possibly damaging Het
Olfr90 G A 17: 37,085,451 T238I probably damaging Het
Onecut2 A T 18: 64,340,927 H183L possibly damaging Het
Pcdhb21 G T 18: 37,515,077 V420F possibly damaging Het
Pcdhb9 G A 18: 37,403,233 G760D probably benign Het
Pglyrp2 G A 17: 32,418,797 P86S probably benign Het
Phyhip T A 14: 70,467,325 V328E probably damaging Het
Pitpnb A T 5: 111,382,996 K218N possibly damaging Het
Pitrm1 A G 13: 6,578,560 D963G probably damaging Het
Pmfbp1 A G 8: 109,532,160 Y699C probably damaging Het
Pmpcb T A 5: 21,740,662 probably benign Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Prss41 A T 17: 23,837,003 M252K probably benign Het
Prss46 A T 9: 110,844,550 M1L possibly damaging Het
Rimklb T C 6: 122,464,092 probably null Het
Rngtt T C 4: 33,500,335 I556T unknown Het
Rock1 A C 18: 10,122,698 D374E probably benign Het
Rspry1 C A 8: 94,658,789 H450N probably benign Het
Rusc2 T C 4: 43,423,942 V1032A probably damaging Het
Sacs A G 14: 61,212,198 R3898G probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Sipa1l1 C A 12: 82,342,333 S444R probably damaging Het
Sntg1 T A 1: 8,363,594 I478F probably damaging Het
Sptb G T 12: 76,609,037 L1424M probably benign Het
Sry T A Y: 2,663,105 H185L unknown Het
Stox2 T G 8: 47,203,163 T93P probably damaging Het
Tatdn2 T A 6: 113,704,605 F472Y possibly damaging Het
Tefm A T 11: 80,140,359 V17D possibly damaging Het
Tekt2 G T 4: 126,324,667 T70N probably benign Het
Ticam1 T C 17: 56,271,642 D151G probably damaging Het
Tmem2 T C 19: 21,856,164 V1322A probably benign Het
Tmem63c A G 12: 87,089,365 E785G probably damaging Het
Tnmd A T X: 133,864,802 N219I probably benign Het
Ttc14 T A 3: 33,806,875 L407* probably null Het
Ttll7 T C 3: 146,894,177 M1T probably null Het
Ttn T A 2: 76,916,491 probably null Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Uggt2 T C 14: 119,049,253 T224A probably damaging Het
Uggt2 A T 14: 119,077,650 probably null Het
Umodl1 A G 17: 30,999,201 E1254G probably damaging Het
Unc5d A G 8: 28,666,899 F773L probably benign Het
Unc80 C A 1: 66,644,447 P2216Q probably damaging Het
Usp40 T A 1: 87,986,201 probably null Het
Vmn1r117 A T 7: 20,883,496 M209K probably damaging Het
Vmn2r44 A T 7: 8,377,986 W303R probably benign Het
Wnk2 G A 13: 49,071,002 R268C probably damaging Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Xkr6 T C 14: 63,819,504 V288A unknown Het
Zfp125 A G 12: 20,900,458 noncoding transcript Het
Zfp512b A C 2: 181,587,063 V703G probably damaging Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zgpat T C 2: 181,378,858 S275P probably benign Het
Other mutations in Gnas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Gnas APN 2 174341711 splice site probably benign
IGL00928:Gnas APN 2 174297953 nonsense probably null
IGL01014:Gnas APN 2 174297974 utr 5 prime probably benign
IGL01743:Gnas APN 2 174298332 nonsense probably null
IGL01808:Gnas APN 2 174298697 missense probably damaging 0.96
IGL02559:Gnas APN 2 174341936 splice site probably benign
R0555:Gnas UTSW 2 174298511 missense possibly damaging 0.78
R0627:Gnas UTSW 2 174298135 intron probably benign
R1418:Gnas UTSW 2 174345214 splice site probably benign
R1706:Gnas UTSW 2 174299975 missense possibly damaging 0.90
R1751:Gnas UTSW 2 174297894 utr 5 prime probably benign
R1968:Gnas UTSW 2 174298733 missense probably damaging 0.96
R2290:Gnas UTSW 2 174300010 missense probably benign 0.09
R4125:Gnas UTSW 2 174300165 missense possibly damaging 0.94
R4128:Gnas UTSW 2 174300165 missense possibly damaging 0.94
R4697:Gnas UTSW 2 174298080 missense probably damaging 1.00
R5458:Gnas UTSW 2 174298331 missense probably benign 0.41
R5640:Gnas UTSW 2 174284971 missense probably benign 0.44
R5696:Gnas UTSW 2 174299675 intron probably benign
R5757:Gnas UTSW 2 174345247 missense probably damaging 1.00
R6053:Gnas UTSW 2 174299852 missense possibly damaging 0.89
R6083:Gnas UTSW 2 174297862 start codon destroyed probably null
R6736:Gnas UTSW 2 174334251 missense probably damaging 0.98
R7074:Gnas UTSW 2 174285049 missense probably damaging 1.00
R7239:Gnas UTSW 2 174298615 missense unknown
R7541:Gnas UTSW 2 174298099 missense unknown
R7679:Gnas UTSW 2 174284831 missense probably damaging 0.99
R7694:Gnas UTSW 2 174300212 missense probably damaging 1.00
R7713:Gnas UTSW 2 174299027 missense unknown
X0022:Gnas UTSW 2 174299744 missense probably benign 0.33
Z1088:Gnas UTSW 2 174298373 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGCAATAATATGTCAGGACAACAC -3'
(R):5'- CCAAAATCGCTGGGTTGAAGG -3'

Sequencing Primer
(F):5'- TATGTCAGGACAACACGATATCC -3'
(R):5'- GCTTGGAGGCCTGATGG -3'
Posted On2016-03-17