Incidental Mutation 'R0295:Cacna1i'
ID 37708
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Name calcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission 038512-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0295 (G1)
Quality Score 200
Status Validated
Chromosome 15
Chromosomal Location 80171439-80282480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80240412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 378 (L378Q)
Ref Sequence ENSEMBL: ENSMUSP00000125229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
AlphaFold E9Q7P2
Predicted Effect probably damaging
Transcript: ENSMUST00000160424
AA Change: L378Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: L378Q

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162155
AA Change: L378Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: L378Q

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Meta Mutation Damage Score 0.5156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik G A 10: 76,290,642 (GRCm39) S127N probably damaging Het
Abcc8 T C 7: 45,767,478 (GRCm39) R953G probably benign Het
Adamtsl3 T A 7: 82,197,213 (GRCm39) probably null Het
Adh4 A G 3: 138,134,837 (GRCm39) D337G probably damaging Het
Apob T A 12: 8,052,181 (GRCm39) Y1207* probably null Het
Birc6 T C 17: 74,920,357 (GRCm39) probably benign Het
Bms1 A G 6: 118,366,298 (GRCm39) I1065T probably benign Het
Ccdc127 C A 13: 74,504,989 (GRCm39) P179H probably damaging Het
Ccdc18 A T 5: 108,321,655 (GRCm39) K586N probably damaging Het
Cep290 A C 10: 100,373,683 (GRCm39) E1321A probably damaging Het
Cstpp1 A T 2: 91,112,939 (GRCm39) I173N probably damaging Het
Ctc1 A G 11: 68,921,414 (GRCm39) K682E possibly damaging Het
Cux1 A C 5: 136,342,066 (GRCm39) V442G probably benign Het
Dph2 A T 4: 117,748,127 (GRCm39) V150E possibly damaging Het
Etv6 A G 6: 134,243,238 (GRCm39) D331G probably benign Het
Fbxo42 A G 4: 140,927,808 (GRCm39) D696G probably damaging Het
Fbxo8 G A 8: 57,043,109 (GRCm39) D198N probably benign Het
Gria4 T C 9: 4,793,840 (GRCm39) T73A possibly damaging Het
H2aj C G 6: 136,785,602 (GRCm39) R89G probably damaging Het
Ifng G T 10: 118,277,154 (GRCm39) S32I possibly damaging Het
Ildr1 A G 16: 36,529,839 (GRCm39) probably null Het
Knl1 A C 2: 118,919,320 (GRCm39) D1824A probably damaging Het
Lamp3 A T 16: 19,519,858 (GRCm39) Y108* probably null Het
Lcp1 A G 14: 75,436,860 (GRCm39) I69V probably null Het
Lrp6 A T 6: 134,434,656 (GRCm39) V1349E probably benign Het
Lrrcc1 A T 3: 14,630,909 (GRCm39) E1009D probably benign Het
Marf1 C T 16: 13,960,398 (GRCm39) A549T probably damaging Het
Med14 G C X: 12,551,987 (GRCm39) R1223G probably damaging Het
Mesd C T 7: 83,547,073 (GRCm39) Q179* probably null Het
Myh7 A G 14: 55,222,278 (GRCm39) probably benign Het
Myo6 T C 9: 80,190,861 (GRCm39) I804T probably damaging Het
Neb T C 2: 52,174,297 (GRCm39) I1521V possibly damaging Het
Nosip T A 7: 44,726,340 (GRCm39) I249N probably damaging Het
Nostrin A C 2: 69,009,760 (GRCm39) E296A probably benign Het
Oprk1 T C 1: 5,669,073 (GRCm39) L173S possibly damaging Het
Or2n1d A T 17: 38,646,182 (GRCm39) I45F probably damaging Het
Or4k36 T A 2: 111,146,499 (GRCm39) V225D probably damaging Het
Or51v8 T C 7: 103,319,518 (GRCm39) H240R probably damaging Het
Or5p1 T G 7: 107,916,892 (GRCm39) S264A probably benign Het
Pdzd7 A G 19: 45,025,511 (GRCm39) V328A probably benign Het
Podxl2 A T 6: 88,826,660 (GRCm39) S215R probably benign Het
Prss36 T G 7: 127,535,027 (GRCm39) T418P possibly damaging Het
Ralgps2 T A 1: 156,651,555 (GRCm39) probably benign Het
Rasa2 T C 9: 96,427,863 (GRCm39) probably null Het
Rgs1 A T 1: 144,121,224 (GRCm39) I149N probably damaging Het
Rgs16 A G 1: 153,619,483 (GRCm39) E163G probably damaging Het
Rnf121 A G 7: 101,684,553 (GRCm39) F120S possibly damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slfn8 A T 11: 82,894,169 (GRCm39) Y823* probably null Het
Spdl1 A T 11: 34,704,170 (GRCm39) N554K possibly damaging Het
St6gal1 T A 16: 23,174,953 (GRCm39) probably benign Het
Tet3 G A 6: 83,346,121 (GRCm39) P1304S probably benign Het
Timm29 T C 9: 21,504,372 (GRCm39) probably null Het
Tpcn1 T A 5: 120,677,125 (GRCm39) I687F probably damaging Het
Trim46 A G 3: 89,152,420 (GRCm39) probably benign Het
Ttc23 T A 7: 67,319,600 (GRCm39) probably benign Het
Ttll6 G T 11: 96,045,540 (GRCm39) V586L probably benign Het
Ttn A T 2: 76,588,955 (GRCm39) probably benign Het
Uba3 A T 6: 97,168,544 (GRCm39) H160Q possibly damaging Het
Usp32 A G 11: 84,944,518 (GRCm39) S316P probably damaging Het
Vcan T C 13: 89,860,310 (GRCm39) I352M probably benign Het
Zcwpw1 G T 5: 137,815,734 (GRCm39) L412F probably damaging Het
Zfp292 A T 4: 34,806,281 (GRCm39) N2254K probably damaging Het
Zscan4e A G 7: 11,041,543 (GRCm39) S138P probably damaging Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80,266,220 (GRCm39) missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80,239,846 (GRCm39) missense probably benign
IGL01338:Cacna1i APN 15 80,232,581 (GRCm39) missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80,271,960 (GRCm39) splice site probably benign
IGL01669:Cacna1i APN 15 80,275,958 (GRCm39) missense probably benign
IGL01807:Cacna1i APN 15 80,258,348 (GRCm39) missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80,275,933 (GRCm39) missense probably benign 0.09
IGL01973:Cacna1i APN 15 80,266,234 (GRCm39) missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80,257,152 (GRCm39) missense probably benign 0.06
IGL02519:Cacna1i APN 15 80,246,075 (GRCm39) nonsense probably null
IGL02648:Cacna1i APN 15 80,182,839 (GRCm39) missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80,246,440 (GRCm39) missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80,239,917 (GRCm39) missense probably benign 0.30
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80,265,373 (GRCm39) missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80,256,663 (GRCm39) missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80,253,031 (GRCm39) splice site probably benign
R0637:Cacna1i UTSW 15 80,256,855 (GRCm39) missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80,265,281 (GRCm39) missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80,243,150 (GRCm39) missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80,263,255 (GRCm39) missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80,275,975 (GRCm39) splice site probably null
R1563:Cacna1i UTSW 15 80,205,389 (GRCm39) missense probably damaging 0.97
R1563:Cacna1i UTSW 15 80,274,056 (GRCm39) splice site probably benign
R1573:Cacna1i UTSW 15 80,277,869 (GRCm39) splice site probably null
R1654:Cacna1i UTSW 15 80,273,411 (GRCm39) missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80,273,323 (GRCm39) missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80,260,990 (GRCm39) missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80,243,132 (GRCm39) missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80,243,145 (GRCm39) missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80,275,843 (GRCm39) missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80,259,465 (GRCm39) missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80,279,245 (GRCm39) missense probably benign
R2162:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80,258,968 (GRCm39) missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3702:Cacna1i UTSW 15 80,265,272 (GRCm39) splice site probably benign
R3832:Cacna1i UTSW 15 80,240,388 (GRCm39) missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80,272,680 (GRCm39) missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80,253,863 (GRCm39) missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80,252,872 (GRCm39) missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80,232,650 (GRCm39) missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80,275,041 (GRCm39) missense possibly damaging 0.94
R5437:Cacna1i UTSW 15 80,255,730 (GRCm39) missense probably damaging 1.00
R5519:Cacna1i UTSW 15 80,255,700 (GRCm39) missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80,279,279 (GRCm39) missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80,273,333 (GRCm39) missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80,205,427 (GRCm39) missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80,220,883 (GRCm39) missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80,239,959 (GRCm39) missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80,262,448 (GRCm39) missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80,205,460 (GRCm39) missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80,259,010 (GRCm39) missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80,259,002 (GRCm39) missense probably damaging 1.00
R7017:Cacna1i UTSW 15 80,264,671 (GRCm39) missense probably damaging 1.00
R7155:Cacna1i UTSW 15 80,279,439 (GRCm39) missense probably benign 0.04
R7274:Cacna1i UTSW 15 80,261,023 (GRCm39) missense possibly damaging 0.95
R7323:Cacna1i UTSW 15 80,275,854 (GRCm39) missense possibly damaging 0.86
R7335:Cacna1i UTSW 15 80,259,776 (GRCm39) missense probably damaging 1.00
R7571:Cacna1i UTSW 15 80,259,537 (GRCm39) missense probably damaging 1.00
R7768:Cacna1i UTSW 15 80,265,389 (GRCm39) missense probably damaging 1.00
R7820:Cacna1i UTSW 15 80,256,573 (GRCm39) missense probably benign 0.00
R7987:Cacna1i UTSW 15 80,204,553 (GRCm39) splice site probably null
R8150:Cacna1i UTSW 15 80,259,540 (GRCm39) missense probably damaging 1.00
R8206:Cacna1i UTSW 15 80,274,016 (GRCm39) splice site probably null
R8270:Cacna1i UTSW 15 80,257,835 (GRCm39) missense probably damaging 0.99
R8382:Cacna1i UTSW 15 80,261,017 (GRCm39) missense probably damaging 0.99
R8501:Cacna1i UTSW 15 80,266,247 (GRCm39) critical splice donor site probably null
R8518:Cacna1i UTSW 15 80,243,095 (GRCm39) nonsense probably null
R8552:Cacna1i UTSW 15 80,204,598 (GRCm39) missense possibly damaging 0.69
R8679:Cacna1i UTSW 15 80,260,011 (GRCm39) intron probably benign
R8696:Cacna1i UTSW 15 80,266,175 (GRCm39) missense probably damaging 0.98
R8887:Cacna1i UTSW 15 80,258,894 (GRCm39) missense possibly damaging 0.91
R9274:Cacna1i UTSW 15 80,254,354 (GRCm39) missense probably damaging 1.00
R9379:Cacna1i UTSW 15 80,259,495 (GRCm39) missense probably damaging 1.00
R9508:Cacna1i UTSW 15 80,279,372 (GRCm39) missense probably benign 0.06
R9518:Cacna1i UTSW 15 80,271,978 (GRCm39) missense probably damaging 1.00
R9674:Cacna1i UTSW 15 80,264,629 (GRCm39) missense probably damaging 1.00
R9747:Cacna1i UTSW 15 80,246,318 (GRCm39) missense probably benign 0.11
R9769:Cacna1i UTSW 15 80,253,793 (GRCm39) missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80,246,163 (GRCm39) missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80,246,340 (GRCm39) missense probably benign 0.03
X0058:Cacna1i UTSW 15 80,263,303 (GRCm39) missense probably damaging 1.00
Z1177:Cacna1i UTSW 15 80,273,584 (GRCm39) missense possibly damaging 0.94
Z1177:Cacna1i UTSW 15 80,265,380 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCATCGGTATCTCTTGGAACCTTGG -3'
(R):5'- CAGCAACAGAGCATCTTGTCTACCC -3'

Sequencing Primer
(F):5'- AACCTTGGTTTTCTTACTGGTGC -3'
(R):5'- tcctcctcctcctcctcc -3'
Posted On 2013-05-23