Incidental Mutation 'R4888:Wnk2'
ID377133
Institutional Source Beutler Lab
Gene Symbol Wnk2
Ensembl Gene ENSMUSG00000037989
Gene NameWNK lysine deficient protein kinase 2
SynonymsESTM15, X83337, 1810073P09Rik
MMRRC Submission 042493-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R4888 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49036303-49148014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49071002 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 268 (R268C)
Ref Sequence ENSEMBL: ENSMUSP00000124614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035538] [ENSMUST00000049265] [ENSMUST00000091623] [ENSMUST00000110096] [ENSMUST00000110097] [ENSMUST00000159559] [ENSMUST00000160087] [ENSMUST00000162403] [ENSMUST00000162581]
Predicted Effect probably damaging
Transcript: ENSMUST00000035538
AA Change: R1126C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047231
Gene: ENSMUSG00000037989
AA Change: R1126C

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.5e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 6.72e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
low complexity region 2033 2053 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000049265
AA Change: R1126C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049327
Gene: ENSMUSG00000037989
AA Change: R1126C

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
S_TKc 195 453 3.3e-19 SMART
Pfam:OSR1_C 474 511 5.6e-19 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 9.51e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1703 2.12e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2023 2.12e-5 PROSPERO
low complexity region 2069 2089 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091623
AA Change: R1126C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089212
Gene: ENSMUSG00000037989
AA Change: R1126C

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 1.6e-41 PFAM
Pfam:Pkinase 195 453 1e-54 PFAM
Pfam:OSR1_C 474 511 4e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 1.52e-5 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1713 7.41e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2027 7.41e-5 PROSPERO
low complexity region 2117 2137 N/A INTRINSIC
low complexity region 2191 2202 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110096
AA Change: R1028C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105723
Gene: ENSMUSG00000037989
AA Change: R1028C

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.6e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 1015 1038 N/A INTRINSIC
internal_repeat_1 1064 1087 2.89e-5 PROSPERO
low complexity region 1177 1194 N/A INTRINSIC
low complexity region 1219 1255 N/A INTRINSIC
low complexity region 1331 1343 N/A INTRINSIC
low complexity region 1351 1359 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1489 1498 N/A INTRINSIC
low complexity region 1721 1732 N/A INTRINSIC
coiled coil region 1737 1768 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110097
AA Change: R1126C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105724
Gene: ENSMUSG00000037989
AA Change: R1126C

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.7e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.8e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 1.16e-5 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1713 5.74e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2027 5.74e-5 PROSPERO
low complexity region 2117 2137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159559
AA Change: R1114C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123915
Gene: ENSMUSG00000037989
AA Change: R1114C

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.7e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.8e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 736 N/A INTRINSIC
low complexity region 759 791 N/A INTRINSIC
low complexity region 809 819 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 926 942 N/A INTRINSIC
low complexity region 971 1002 N/A INTRINSIC
low complexity region 1009 1036 N/A INTRINSIC
low complexity region 1101 1124 N/A INTRINSIC
internal_repeat_1 1150 1173 7.19e-6 PROSPERO
low complexity region 1263 1280 N/A INTRINSIC
low complexity region 1305 1341 N/A INTRINSIC
low complexity region 1417 1429 N/A INTRINSIC
low complexity region 1437 1445 N/A INTRINSIC
low complexity region 1452 1477 N/A INTRINSIC
low complexity region 1575 1585 N/A INTRINSIC
internal_repeat_2 1599 1701 3.66e-5 PROSPERO
low complexity region 1808 1819 N/A INTRINSIC
coiled coil region 1824 1855 N/A INTRINSIC
internal_repeat_2 1911 2015 3.66e-5 PROSPERO
low complexity region 2105 2125 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000159633
AA Change: R5C
Predicted Effect probably damaging
Transcript: ENSMUST00000160087
AA Change: R268C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124614
Gene: ENSMUSG00000037989
AA Change: R268C

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 115 130 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
low complexity region 255 278 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
low complexity region 459 495 N/A INTRINSIC
low complexity region 571 583 N/A INTRINSIC
low complexity region 591 599 N/A INTRINSIC
low complexity region 606 631 N/A INTRINSIC
low complexity region 729 738 N/A INTRINSIC
low complexity region 961 972 N/A INTRINSIC
coiled coil region 977 1008 N/A INTRINSIC
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162403
AA Change: R1016C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125539
Gene: ENSMUSG00000037989
AA Change: R1016C

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.3e-42 PFAM
Pfam:Pkinase 195 453 1.6e-56 PFAM
Pfam:OSR1_C 474 511 5.3e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 736 N/A INTRINSIC
low complexity region 759 791 N/A INTRINSIC
low complexity region 809 819 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 926 942 N/A INTRINSIC
low complexity region 1003 1026 N/A INTRINSIC
internal_repeat_1 1052 1075 1.05e-5 PROSPERO
low complexity region 1165 1182 N/A INTRINSIC
low complexity region 1207 1243 N/A INTRINSIC
low complexity region 1319 1331 N/A INTRINSIC
low complexity region 1339 1347 N/A INTRINSIC
low complexity region 1354 1379 N/A INTRINSIC
low complexity region 1477 1487 N/A INTRINSIC
internal_repeat_2 1501 1593 2.32e-5 PROSPERO
low complexity region 1710 1721 N/A INTRINSIC
coiled coil region 1726 1757 N/A INTRINSIC
internal_repeat_2 1813 1913 2.32e-5 PROSPERO
low complexity region 1959 1979 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162581
AA Change: R1126C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125448
Gene: ENSMUSG00000037989
AA Change: R1126C

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.5e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 6.72e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
low complexity region 2033 2053 N/A INTRINSIC
Meta Mutation Damage Score 0.2608 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (150/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic serine-threonine kinase that belongs to the protein kinase superfamily. The protein plays an important role in the regulation of electrolyte homeostasis, cell signaling survival, and proliferation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931403M11Rik C A 14: 24,621,351 noncoding transcript Het
4931408C20Rik A G 1: 26,683,547 Y851H probably benign Het
Abca7 A G 10: 80,002,728 K612R probably damaging Het
Adamtsl3 T C 7: 82,574,614 V275A possibly damaging Het
Afg3l1 G A 8: 123,488,326 probably null Het
Alcam T A 16: 52,268,813 H508L probably benign Het
Ankrd45 G A 1: 161,155,372 R151H probably damaging Het
Aqr G A 2: 114,150,509 L264F probably damaging Het
Arfgef2 G A 2: 166,835,613 A53T probably damaging Het
Arhgap30 A G 1: 171,409,312 T1085A probably benign Het
Atp10a T C 7: 58,785,307 V314A probably damaging Het
Bdp1 T C 13: 100,051,119 D1580G probably benign Het
Btbd17 T A 11: 114,794,091 T41S possibly damaging Het
Cacna1c T C 6: 118,751,439 N378S probably damaging Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Ccar1 A G 10: 62,753,218 S829P unknown Het
Ccdc180 T C 4: 45,909,308 L492P probably damaging Het
Ccser2 A T 14: 36,940,386 N280K probably damaging Het
Cd37 T C 7: 45,233,935 D271G probably damaging Het
Cdcp1 G A 9: 123,182,129 probably benign Het
Cep85 T A 4: 134,164,751 probably benign Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Csmd1 A G 8: 15,895,674 probably benign Het
Cytl1 G T 5: 37,735,574 L9F unknown Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Degs1 G A 1: 182,276,805 T305I probably damaging Het
Dnttip2 T G 3: 122,276,592 C485W probably damaging Het
Ecel1 G A 1: 87,148,727 probably benign Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Elmo2 A T 2: 165,295,289 C562S probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
F2r A C 13: 95,604,397 V210G probably damaging Het
Fam171a1 T A 2: 3,223,509 V179E probably damaging Het
Fmod G T 1: 134,040,239 V6F possibly damaging Het
Foxr2 A G X: 153,130,316 Q61R probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gck A T 11: 5,909,150 M139K possibly damaging Het
Gif A G 19: 11,752,219 T181A probably benign Het
Gm10192 C G 4: 97,183,108 S20T probably null Het
Gm13088 A G 4: 143,654,401 S351P probably benign Het
Gm44501 T C 17: 40,576,624 L11P unknown Het
Gm572 T C 4: 148,666,845 probably null Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Gnas A G 2: 174,298,089 K17R possibly damaging Het
Grm2 T A 9: 106,650,666 S340C probably damaging Het
Gsc T A 12: 104,472,015 H198L probably damaging Het
H2-Q3 A T 17: 35,359,448 noncoding transcript Het
Hist1h4a T C 13: 23,760,952 D69G probably damaging Het
Hivep3 A G 4: 120,122,934 E1723G probably damaging Het
Hk3 A T 13: 55,006,592 L757Q probably damaging Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Ier3ip1 T A 18: 76,939,531 probably benign Het
Itch T A 2: 155,217,977 probably null Het
Kalrn T A 16: 34,171,330 Q974L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Klhl9 T C 4: 88,721,945 K20E probably benign Het
Kmt2a G T 9: 44,821,680 probably benign Het
Krt17 C A 11: 100,256,479 V409L probably benign Het
Lmx1b T C 2: 33,564,790 N322S probably benign Het
Lrrc63 G C 14: 75,125,966 P242A probably benign Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Map3k19 T A 1: 127,817,733 E1328V probably damaging Het
Map4k2 C T 19: 6,344,003 A280V probably benign Het
Mettl11b A T 1: 163,703,064 C269S probably benign Het
Micall1 C T 15: 79,131,848 R802* probably null Het
Mmp14 A G 14: 54,436,205 R109G probably damaging Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mpeg1 A G 19: 12,463,070 T631A probably damaging Het
Mpnd A G 17: 56,011,641 M217V probably benign Het
Mrc2 T C 11: 105,341,208 V862A probably damaging Het
Mug2 T A 6: 122,081,195 S1239T probably damaging Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo18b A T 5: 112,874,480 probably benign Het
Myo1c C A 11: 75,669,227 T703N probably damaging Het
Myt1l T G 12: 29,886,139 C909G unknown Het
Nbea T C 3: 56,005,355 S1004G possibly damaging Het
Neb T C 2: 52,296,307 N918D probably benign Het
Nrtn T C 17: 56,751,636 T122A probably damaging Het
Nsd3 A T 8: 25,698,911 S1042C probably damaging Het
Nvl A G 1: 181,117,626 L461S probably damaging Het
Olfr1339 A C 4: 118,734,688 H53P probably benign Het
Olfr1346 A T 7: 6,474,613 I168F probably damaging Het
Olfr1425 C G 19: 12,074,315 G106R probably damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr786 A C 10: 129,437,379 D189A possibly damaging Het
Olfr90 G A 17: 37,085,451 T238I probably damaging Het
Onecut2 A T 18: 64,340,927 H183L possibly damaging Het
Pcdhb21 G T 18: 37,515,077 V420F possibly damaging Het
Pcdhb9 G A 18: 37,403,233 G760D probably benign Het
Pglyrp2 G A 17: 32,418,797 P86S probably benign Het
Phyhip T A 14: 70,467,325 V328E probably damaging Het
Pitpnb A T 5: 111,382,996 K218N possibly damaging Het
Pitrm1 A G 13: 6,578,560 D963G probably damaging Het
Pmfbp1 A G 8: 109,532,160 Y699C probably damaging Het
Pmpcb T A 5: 21,740,662 probably benign Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Prss41 A T 17: 23,837,003 M252K probably benign Het
Prss46 A T 9: 110,844,550 M1L possibly damaging Het
Rimklb T C 6: 122,464,092 probably null Het
Rngtt T C 4: 33,500,335 I556T unknown Het
Rock1 A C 18: 10,122,698 D374E probably benign Het
Rspry1 C A 8: 94,658,789 H450N probably benign Het
Rusc2 T C 4: 43,423,942 V1032A probably damaging Het
Sacs A G 14: 61,212,198 R3898G probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Sipa1l1 C A 12: 82,342,333 S444R probably damaging Het
Sntg1 T A 1: 8,363,594 I478F probably damaging Het
Sptb G T 12: 76,609,037 L1424M probably benign Het
Sry T A Y: 2,663,105 H185L unknown Het
Stox2 T G 8: 47,203,163 T93P probably damaging Het
Tatdn2 T A 6: 113,704,605 F472Y possibly damaging Het
Tefm A T 11: 80,140,359 V17D possibly damaging Het
Tekt2 G T 4: 126,324,667 T70N probably benign Het
Ticam1 T C 17: 56,271,642 D151G probably damaging Het
Tmem2 T C 19: 21,856,164 V1322A probably benign Het
Tmem63c A G 12: 87,089,365 E785G probably damaging Het
Tnmd A T X: 133,864,802 N219I probably benign Het
Ttc14 T A 3: 33,806,875 L407* probably null Het
Ttll7 T C 3: 146,894,177 M1T probably null Het
Ttn T A 2: 76,916,491 probably null Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Uggt2 T C 14: 119,049,253 T224A probably damaging Het
Uggt2 A T 14: 119,077,650 probably null Het
Umodl1 A G 17: 30,999,201 E1254G probably damaging Het
Unc5d A G 8: 28,666,899 F773L probably benign Het
Unc80 C A 1: 66,644,447 P2216Q probably damaging Het
Usp40 T A 1: 87,986,201 probably null Het
Vmn1r117 A T 7: 20,883,496 M209K probably damaging Het
Vmn2r44 A T 7: 8,377,986 W303R probably benign Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Xkr6 T C 14: 63,819,504 V288A unknown Het
Zfp125 A G 12: 20,900,458 noncoding transcript Het
Zfp512b A C 2: 181,587,063 V703G probably damaging Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zgpat T C 2: 181,378,858 S275P probably benign Het
Other mutations in Wnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Wnk2 APN 13 49068192 missense possibly damaging 0.89
IGL01575:Wnk2 APN 13 49146676 missense probably damaging 1.00
IGL01601:Wnk2 APN 13 49076562 missense probably damaging 1.00
IGL01775:Wnk2 APN 13 49071110 missense probably damaging 1.00
IGL02013:Wnk2 APN 13 49082034 missense possibly damaging 0.46
IGL02016:Wnk2 APN 13 49056905 missense probably damaging 1.00
IGL02167:Wnk2 APN 13 49071125 critical splice acceptor site probably null
IGL02174:Wnk2 APN 13 49057167 missense probably damaging 1.00
IGL02210:Wnk2 APN 13 49090869 missense probably damaging 0.98
IGL02228:Wnk2 APN 13 49056940 missense probably damaging 1.00
IGL02282:Wnk2 APN 13 49068125 missense probably damaging 1.00
IGL02319:Wnk2 APN 13 49061438 missense possibly damaging 0.73
IGL02394:Wnk2 APN 13 49081899 splice site probably null
IGL02624:Wnk2 APN 13 49102802 missense probably damaging 1.00
IGL02743:Wnk2 APN 13 49095444 missense probably damaging 1.00
IGL03012:Wnk2 APN 13 49044389 missense probably damaging 0.99
IGL03166:Wnk2 APN 13 49071044 nonsense probably null
R0034:Wnk2 UTSW 13 49068080 missense possibly damaging 0.64
R0385:Wnk2 UTSW 13 49068128 missense probably damaging 1.00
R0423:Wnk2 UTSW 13 49095418 missense possibly damaging 0.91
R0504:Wnk2 UTSW 13 49085394 missense possibly damaging 0.92
R0504:Wnk2 UTSW 13 49085396 missense probably damaging 1.00
R0653:Wnk2 UTSW 13 49057016 missense possibly damaging 0.85
R1135:Wnk2 UTSW 13 49076558 missense probably damaging 1.00
R1445:Wnk2 UTSW 13 49071110 missense probably damaging 1.00
R1464:Wnk2 UTSW 13 49081975 missense probably damaging 1.00
R1464:Wnk2 UTSW 13 49081975 missense probably damaging 1.00
R1468:Wnk2 UTSW 13 49082095 missense probably damaging 0.99
R1468:Wnk2 UTSW 13 49082095 missense probably damaging 0.99
R1480:Wnk2 UTSW 13 49057232 missense probably damaging 1.00
R1605:Wnk2 UTSW 13 49060894 missense probably damaging 1.00
R1719:Wnk2 UTSW 13 49060726 missense possibly damaging 0.76
R1891:Wnk2 UTSW 13 49052724 nonsense probably null
R1966:Wnk2 UTSW 13 49039011 missense probably damaging 0.96
R2001:Wnk2 UTSW 13 49078682 missense possibly damaging 0.61
R2310:Wnk2 UTSW 13 49050577 missense probably damaging 0.97
R2356:Wnk2 UTSW 13 49039168 nonsense probably null
R2406:Wnk2 UTSW 13 49061488 missense possibly damaging 0.86
R2519:Wnk2 UTSW 13 49071029 missense probably damaging 0.99
R3962:Wnk2 UTSW 13 49070977 missense probably damaging 1.00
R4160:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4161:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4226:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4227:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4234:Wnk2 UTSW 13 49061128 missense probably benign 0.33
R4304:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4308:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4584:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4655:Wnk2 UTSW 13 49056883 missense probably damaging 1.00
R4715:Wnk2 UTSW 13 49147232 start codon destroyed unknown
R4887:Wnk2 UTSW 13 49071002 missense probably damaging 1.00
R4945:Wnk2 UTSW 13 49057246 missense probably damaging 1.00
R5182:Wnk2 UTSW 13 49061161 missense possibly damaging 0.92
R5243:Wnk2 UTSW 13 49072578 missense possibly damaging 0.51
R5370:Wnk2 UTSW 13 49102961 missense probably damaging 1.00
R5771:Wnk2 UTSW 13 49102800 missense probably damaging 1.00
R5877:Wnk2 UTSW 13 49067306 missense probably damaging 0.98
R5900:Wnk2 UTSW 13 49102832 missense probably damaging 1.00
R5905:Wnk2 UTSW 13 49076345 missense probably damaging 0.99
R5912:Wnk2 UTSW 13 49060774 missense probably damaging 1.00
R5915:Wnk2 UTSW 13 49078085 missense probably damaging 0.99
R6028:Wnk2 UTSW 13 49076345 missense probably damaging 0.99
R6074:Wnk2 UTSW 13 49051399 missense probably damaging 1.00
R6171:Wnk2 UTSW 13 49060832 missense probably damaging 1.00
R6368:Wnk2 UTSW 13 49061338 missense probably damaging 0.99
R6467:Wnk2 UTSW 13 49146605 missense probably damaging 1.00
R6501:Wnk2 UTSW 13 49146683 missense probably damaging 1.00
R6849:Wnk2 UTSW 13 49067358 missense probably damaging 1.00
R6898:Wnk2 UTSW 13 49071081 missense probably damaging 1.00
R6949:Wnk2 UTSW 13 49101140 missense probably damaging 1.00
R7011:Wnk2 UTSW 13 49071091 missense probably damaging 0.99
R7097:Wnk2 UTSW 13 49102838 missense possibly damaging 0.86
R7121:Wnk2 UTSW 13 49147177 missense probably benign 0.26
R7123:Wnk2 UTSW 13 49081986 missense possibly damaging 0.90
R7423:Wnk2 UTSW 13 49038132 missense probably benign 0.07
R7502:Wnk2 UTSW 13 49147244 splice site probably null
R7529:Wnk2 UTSW 13 49100981 missense possibly damaging 0.50
X0025:Wnk2 UTSW 13 49060942 missense probably damaging 0.99
X0063:Wnk2 UTSW 13 49038977 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACGTGGCAATCTCATCCGG -3'
(R):5'- TGGGTTTTCTGGCAATCCAC -3'

Sequencing Primer
(F):5'- CCATCGAGGTCAAACTTGAAGGTC -3'
(R):5'- TCTGGCAATCCACATAATGCTG -3'
Posted On2016-03-17