Incidental Mutation 'R4889:Flvcr1'
ID377177
Institutional Source Beutler Lab
Gene Symbol Flvcr1
Ensembl Gene ENSMUSG00000066595
Gene Namefeline leukemia virus subgroup C cellular receptor 1
SynonymsMfsd7b, 9630055N22Rik
MMRRC Submission 042494-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4889 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location191005847-191026158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 191025567 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 176 (L176P)
Ref Sequence ENSEMBL: ENSMUSP00000141578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085635] [ENSMUST00000191946] [ENSMUST00000192666]
Predicted Effect probably damaging
Transcript: ENSMUST00000085635
AA Change: L176P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082777
Gene: ENSMUSG00000066595
AA Change: L176P

DomainStartEndE-ValueType
low complexity region 40 68 N/A INTRINSIC
Pfam:MFS_1 100 483 1.5e-28 PFAM
transmembrane domain 498 517 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181050
SMART Domains Protein: ENSMUSP00000138069
Gene: ENSMUSG00000097845

DomainStartEndE-ValueType
low complexity region 97 106 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 246 265 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191946
AA Change: L176P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141578
Gene: ENSMUSG00000066595
AA Change: L176P

DomainStartEndE-ValueType
low complexity region 40 68 N/A INTRINSIC
Pfam:MFS_1 96 243 2.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192407
Predicted Effect probably damaging
Transcript: ENSMUST00000192666
AA Change: L134P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141985
Gene: ENSMUSG00000066595
AA Change: L134P

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:MFS_1 54 198 3.1e-9 PFAM
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the major facilitator superfamily of transporter proteins. The encoded protein is a heme transporter that may play a critical role in erythropoiesis by protecting developing erythroid cells from heme toxicity. This gene may play a role in posterior column ataxia with retinitis pigmentosa and the hematological disorder Diamond-Blackfan syndrome. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit runting, cardiomegaly and splenomegaly, lack definitive erythropoiesis, develop severe hyperchromic macrocytic anemia and reticulocytopenia, and show craniofacial and limb defects and intrauterine lethality modulated by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ado G C 10: 67,548,305 R157G probably benign Het
Akap12 C A 10: 4,356,535 A1115E probably damaging Het
Ankhd1 A G 18: 36,578,734 M196V probably null Het
Appl2 G A 10: 83,641,058 T34I probably damaging Het
Arhgap21 T C 2: 20,880,468 S472G probably benign Het
Asmt G T X: 170,677,029 R250L possibly damaging Het
Baz2b A T 2: 59,936,726 I870N probably damaging Het
Card11 T C 5: 140,885,945 Q667R possibly damaging Het
Cercam A G 2: 29,881,833 D555G probably damaging Het
Cop1 A T 1: 159,284,589 R284S probably damaging Het
Cr2 A G 1: 195,176,585 V9A possibly damaging Het
Ctsm A G 13: 61,538,401 F106S probably damaging Het
Dhx9 A T 1: 153,481,149 L118Q probably damaging Het
Dnah5 G T 15: 28,235,792 C355F probably benign Het
Dock1 C A 7: 134,744,976 N212K probably benign Het
Efemp2 T A 19: 5,475,120 L18Q probably null Het
Gm16505 A T 13: 3,361,125 noncoding transcript Het
Gm6457 A T 18: 14,570,444 noncoding transcript Het
Gnptab A G 10: 88,433,913 N826S probably benign Het
Hdc T G 2: 126,594,133 N606T probably benign Het
Itga3 T C 11: 95,068,301 D113G probably benign Het
Maml3 C T 3: 51,694,510 probably benign Het
Mkrn1 A T 6: 39,420,005 probably benign Het
Myo18a T C 11: 77,832,412 V720A probably damaging Het
Nkx3-1 G A 14: 69,190,998 probably null Het
Npat T C 9: 53,562,207 I433T probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1024 C T 2: 85,904,748 C102Y possibly damaging Het
Olfr1115 A T 2: 87,252,647 I237F probably damaging Het
Olfr365 A G 2: 37,202,045 Y268C probably damaging Het
Pde6c T A 19: 38,133,151 M69K probably benign Het
Pde7b T C 10: 20,548,077 T18A probably benign Het
Plcz1 T C 6: 140,007,748 K381R probably benign Het
Ppfia4 A C 1: 134,300,514 F1095V probably damaging Het
Sfxn3 T C 19: 45,049,815 F78S probably damaging Het
Sim1 A T 10: 50,981,324 Y390F probably benign Het
Slc25a31 A G 3: 40,721,545 I174V probably benign Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slco1b2 T G 6: 141,656,743 probably benign Het
Smarca5 C A 8: 80,704,697 D964Y possibly damaging Het
Sptbn2 T A 19: 4,729,430 S338R possibly damaging Het
Srcap T C 7: 127,538,547 V1023A possibly damaging Het
Syt16 A G 12: 74,129,495 E46G probably damaging Het
Tas2r114 A T 6: 131,689,795 I90K probably damaging Het
Tlx1 G T 19: 45,150,979 D22Y probably damaging Het
Vamp8 G A 6: 72,385,539 L93F possibly damaging Het
Vill T C 9: 119,063,341 S347P possibly damaging Het
Zfp974 A G 7: 27,910,819 Y494H possibly damaging Het
Other mutations in Flvcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Flvcr1 APN 1 191015489 nonsense probably null
IGL01089:Flvcr1 APN 1 191013390 missense probably damaging 0.98
IGL02572:Flvcr1 APN 1 191025646 missense probably damaging 1.00
IGL03248:Flvcr1 APN 1 191025742 missense probably damaging 1.00
R0009:Flvcr1 UTSW 1 191008191 missense probably benign
R0122:Flvcr1 UTSW 1 191021226 missense possibly damaging 0.79
R0363:Flvcr1 UTSW 1 191012254 splice site probably benign
R0417:Flvcr1 UTSW 1 191011219 missense probably benign 0.05
R0718:Flvcr1 UTSW 1 191025582 missense probably damaging 1.00
R1061:Flvcr1 UTSW 1 191008173 missense probably benign 0.01
R1815:Flvcr1 UTSW 1 191025380 missense probably damaging 1.00
R2029:Flvcr1 UTSW 1 191021156 missense probably benign 0.01
R4590:Flvcr1 UTSW 1 191012146 missense probably benign 0.05
R4766:Flvcr1 UTSW 1 191021106 missense probably benign 0.00
R4976:Flvcr1 UTSW 1 191025495 missense probably damaging 1.00
R5434:Flvcr1 UTSW 1 191026009 missense probably benign 0.07
R5508:Flvcr1 UTSW 1 191025459 missense probably damaging 1.00
R5930:Flvcr1 UTSW 1 191009551 missense probably damaging 1.00
R6698:Flvcr1 UTSW 1 191025732 missense probably damaging 1.00
R6927:Flvcr1 UTSW 1 191025664 missense possibly damaging 0.66
R7544:Flvcr1 UTSW 1 191025946 missense probably damaging 0.99
R7654:Flvcr1 UTSW 1 191011605 missense possibly damaging 0.83
R7853:Flvcr1 UTSW 1 191025646 missense probably damaging 1.00
R7936:Flvcr1 UTSW 1 191025646 missense probably damaging 1.00
X0064:Flvcr1 UTSW 1 191025447 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGTCTTTACCTGATTGCCCAG -3'
(R):5'- TTTACTCGCTGGTGAACGCC -3'

Sequencing Primer
(F):5'- ACCTGATTGCCCAGCACTG -3'
(R):5'- TTCCAGTGGATCCAGTACAGCAG -3'
Posted On2016-03-17