Mutagenetix > Incidental Mutation

Incidental Mutation 'R4889:Cr2'

377178

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

042494-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R4889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 195176585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 9 (V9A)

Ref Sequence

ENSEMBL: ENSMUSP00000147804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000082321
AA Change: V9A

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: V9A

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000193801
AA Change: V9A

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616
AA Change: V9A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195120
AA Change: V9A

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: V9A

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195347

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195722

Predicted Effect

possibly damaging
Transcript: ENSMUST00000210219
AA Change: V9A

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)

Meta Mutation Damage Score

0.1388

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ado	G	C	10: 67,548,305	R157G	probably benign	Het
Akap12	C	A	10: 4,356,535	A1115E	probably damaging	Het
Ankhd1	A	G	18: 36,578,734	M196V	probably null	Het
Appl2	G	A	10: 83,641,058	T34I	probably damaging	Het
Arhgap21	T	C	2: 20,880,468	S472G	probably benign	Het
Asmt	G	T	X: 170,677,029	R250L	possibly damaging	Het
Baz2b	A	T	2: 59,936,726	I870N	probably damaging	Het
Card11	T	C	5: 140,885,945	Q667R	possibly damaging	Het
Cercam	A	G	2: 29,881,833	D555G	probably damaging	Het
Cop1	A	T	1: 159,284,589	R284S	probably damaging	Het
Ctsm	A	G	13: 61,538,401	F106S	probably damaging	Het
Dhx9	A	T	1: 153,481,149	L118Q	probably damaging	Het
Dnah5	G	T	15: 28,235,792	C355F	probably benign	Het
Dock1	C	A	7: 134,744,976	N212K	probably benign	Het
Efemp2	T	A	19: 5,475,120	L18Q	probably null	Het
Flvcr1	A	G	1: 191,025,567	L176P	probably damaging	Het
Gm16505	A	T	13: 3,361,125		noncoding transcript	Het
Gm6457	A	T	18: 14,570,444		noncoding transcript	Het
Gnptab	A	G	10: 88,433,913	N826S	probably benign	Het
Hdc	T	G	2: 126,594,133	N606T	probably benign	Het
Itga3	T	C	11: 95,068,301	D113G	probably benign	Het
Maml3	C	T	3: 51,694,510		probably benign	Het
Mkrn1	A	T	6: 39,420,005		probably benign	Het
Myo18a	T	C	11: 77,832,412	V720A	probably damaging	Het
Nkx3-1	G	A	14: 69,190,998		probably null	Het
Npat	T	C	9: 53,562,207	I433T	probably benign	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr1024	C	T	2: 85,904,748	C102Y	possibly damaging	Het
Olfr1115	A	T	2: 87,252,647	I237F	probably damaging	Het
Olfr365	A	G	2: 37,202,045	Y268C	probably damaging	Het
Pde6c	T	A	19: 38,133,151	M69K	probably benign	Het
Pde7b	T	C	10: 20,548,077	T18A	probably benign	Het
Plcz1	T	C	6: 140,007,748	K381R	probably benign	Het
Ppfia4	A	C	1: 134,300,514	F1095V	probably damaging	Het
Sfxn3	T	C	19: 45,049,815	F78S	probably damaging	Het
Sim1	A	T	10: 50,981,324	Y390F	probably benign	Het
Slc25a31	A	G	3: 40,721,545	I174V	probably benign	Het
Slc5a9	C	A	4: 111,891,744		probably null	Het
Slco1b2	T	G	6: 141,656,743		probably benign	Het
Smarca5	C	A	8: 80,704,697	D964Y	possibly damaging	Het
Sptbn2	T	A	19: 4,729,430	S338R	possibly damaging	Het
Srcap	T	C	7: 127,538,547	V1023A	possibly damaging	Het
Syt16	A	G	12: 74,129,495	E46G	probably damaging	Het
Tas2r114	A	T	6: 131,689,795	I90K	probably damaging	Het
Tlx1	G	T	19: 45,150,979	D22Y	probably damaging	Het
Vamp8	G	A	6: 72,385,539	L93F	possibly damaging	Het
Vill	T	C	9: 119,063,341	S347P	possibly damaging	Het
Zfp974	A	G	7: 27,910,819	Y494H	possibly damaging	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- CATCAGGAGACAGAGGGATCTC -3'
(R):5'- GTGCTTCACAAATCTTCAGTACCC -3'

Sequencing Primer
(F):5'- TCTCCAAAGGTGTCAGGGAC -3'
(R):5'- ATCTTCAGTACCCAGCGCC -3'

Posted On

2016-03-17