Incidental Mutation 'R4889:Arhgap21'
ID377179
Institutional Source Beutler Lab
Gene Symbol Arhgap21
Ensembl Gene ENSMUSG00000036591
Gene NameRho GTPase activating protein 21
SynonymsARHGAP10, 5530401C11Rik
MMRRC Submission 042494-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R4889 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location20847919-20968881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20880468 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 472 (S472G)
Ref Sequence ENSEMBL: ENSMUSP00000133347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]
Predicted Effect probably benign
Transcript: ENSMUST00000114594
AA Change: S637G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: S637G

DomainStartEndE-ValueType
PDZ 58 159 1.03e-16 SMART
low complexity region 351 362 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 911 925 N/A INTRINSIC
PH 930 1040 2.09e-16 SMART
RhoGAP 1157 1334 3.26e-62 SMART
low complexity region 1381 1399 N/A INTRINSIC
low complexity region 1448 1466 N/A INTRINSIC
low complexity region 1533 1565 N/A INTRINSIC
low complexity region 1573 1593 N/A INTRINSIC
low complexity region 1891 1900 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141298
AA Change: S643G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: S643G

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154230
AA Change: S643G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: S643G

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173194
AA Change: S633G

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: S633G

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 441 455 N/A INTRINSIC
low complexity region 621 631 N/A INTRINSIC
low complexity region 907 921 N/A INTRINSIC
PH 926 1036 2.09e-16 SMART
RhoGAP 1153 1330 3.26e-62 SMART
low complexity region 1377 1395 N/A INTRINSIC
low complexity region 1444 1462 N/A INTRINSIC
low complexity region 1529 1561 N/A INTRINSIC
low complexity region 1569 1589 N/A INTRINSIC
low complexity region 1887 1896 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174584
AA Change: S472G

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: S472G

DomainStartEndE-ValueType
low complexity region 186 197 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 746 760 N/A INTRINSIC
PH 765 875 2.09e-16 SMART
RhoGAP 992 1169 3.26e-62 SMART
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ado G C 10: 67,548,305 R157G probably benign Het
Akap12 C A 10: 4,356,535 A1115E probably damaging Het
Ankhd1 A G 18: 36,578,734 M196V probably null Het
Appl2 G A 10: 83,641,058 T34I probably damaging Het
Asmt G T X: 170,677,029 R250L possibly damaging Het
Baz2b A T 2: 59,936,726 I870N probably damaging Het
Card11 T C 5: 140,885,945 Q667R possibly damaging Het
Cercam A G 2: 29,881,833 D555G probably damaging Het
Cop1 A T 1: 159,284,589 R284S probably damaging Het
Cr2 A G 1: 195,176,585 V9A possibly damaging Het
Ctsm A G 13: 61,538,401 F106S probably damaging Het
Dhx9 A T 1: 153,481,149 L118Q probably damaging Het
Dnah5 G T 15: 28,235,792 C355F probably benign Het
Dock1 C A 7: 134,744,976 N212K probably benign Het
Efemp2 T A 19: 5,475,120 L18Q probably null Het
Flvcr1 A G 1: 191,025,567 L176P probably damaging Het
Gm16505 A T 13: 3,361,125 noncoding transcript Het
Gm6457 A T 18: 14,570,444 noncoding transcript Het
Gnptab A G 10: 88,433,913 N826S probably benign Het
Hdc T G 2: 126,594,133 N606T probably benign Het
Itga3 T C 11: 95,068,301 D113G probably benign Het
Maml3 C T 3: 51,694,510 probably benign Het
Mkrn1 A T 6: 39,420,005 probably benign Het
Myo18a T C 11: 77,832,412 V720A probably damaging Het
Nkx3-1 G A 14: 69,190,998 probably null Het
Npat T C 9: 53,562,207 I433T probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1024 C T 2: 85,904,748 C102Y possibly damaging Het
Olfr1115 A T 2: 87,252,647 I237F probably damaging Het
Olfr365 A G 2: 37,202,045 Y268C probably damaging Het
Pde6c T A 19: 38,133,151 M69K probably benign Het
Pde7b T C 10: 20,548,077 T18A probably benign Het
Plcz1 T C 6: 140,007,748 K381R probably benign Het
Ppfia4 A C 1: 134,300,514 F1095V probably damaging Het
Sfxn3 T C 19: 45,049,815 F78S probably damaging Het
Sim1 A T 10: 50,981,324 Y390F probably benign Het
Slc25a31 A G 3: 40,721,545 I174V probably benign Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slco1b2 T G 6: 141,656,743 probably benign Het
Smarca5 C A 8: 80,704,697 D964Y possibly damaging Het
Sptbn2 T A 19: 4,729,430 S338R possibly damaging Het
Srcap T C 7: 127,538,547 V1023A possibly damaging Het
Syt16 A G 12: 74,129,495 E46G probably damaging Het
Tas2r114 A T 6: 131,689,795 I90K probably damaging Het
Tlx1 G T 19: 45,150,979 D22Y probably damaging Het
Vamp8 G A 6: 72,385,539 L93F possibly damaging Het
Vill T C 9: 119,063,341 S347P possibly damaging Het
Zfp974 A G 7: 27,910,819 Y494H possibly damaging Het
Other mutations in Arhgap21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Arhgap21 APN 2 20855700 missense probably damaging 1.00
IGL01472:Arhgap21 APN 2 20849581 missense probably damaging 1.00
IGL01634:Arhgap21 APN 2 20914644 missense probably benign 0.00
IGL01766:Arhgap21 APN 2 20849637 missense possibly damaging 0.68
IGL02097:Arhgap21 APN 2 20880002 missense probably benign 0.39
IGL02197:Arhgap21 APN 2 20880306 missense probably benign
IGL02264:Arhgap21 APN 2 20860039 splice site probably null
IGL02346:Arhgap21 APN 2 20879951 splice site probably benign
IGL02418:Arhgap21 APN 2 20880900 missense probably damaging 1.00
IGL02605:Arhgap21 APN 2 20855588 missense probably damaging 1.00
IGL02701:Arhgap21 APN 2 20892091 missense probably damaging 1.00
IGL03019:Arhgap21 APN 2 20861063 missense probably damaging 1.00
IGL03085:Arhgap21 APN 2 20914721 missense probably benign
IGL03265:Arhgap21 APN 2 20849628 missense probably benign 0.03
IGL03379:Arhgap21 APN 2 20880689 missense probably benign 0.41
R0304:Arhgap21 UTSW 2 20859801 splice site probably benign
R0363:Arhgap21 UTSW 2 20881133 missense probably damaging 1.00
R0498:Arhgap21 UTSW 2 20863117 missense probably damaging 1.00
R0539:Arhgap21 UTSW 2 20914799 nonsense probably null
R0633:Arhgap21 UTSW 2 20855387 nonsense probably null
R0905:Arhgap21 UTSW 2 20849934 missense possibly damaging 0.88
R1550:Arhgap21 UTSW 2 20881765 nonsense probably null
R1570:Arhgap21 UTSW 2 20880840 missense probably benign
R1686:Arhgap21 UTSW 2 20881848 missense probably damaging 1.00
R1746:Arhgap21 UTSW 2 20861099 missense probably damaging 0.99
R1864:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R1865:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R2209:Arhgap21 UTSW 2 20849520 missense probably damaging 1.00
R2211:Arhgap21 UTSW 2 20881640 missense possibly damaging 0.56
R2276:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2277:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2279:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2336:Arhgap21 UTSW 2 20880051 missense probably damaging 1.00
R2516:Arhgap21 UTSW 2 20854998 missense probably damaging 1.00
R3722:Arhgap21 UTSW 2 20850291 missense probably damaging 1.00
R3877:Arhgap21 UTSW 2 20859906 missense probably damaging 0.99
R4017:Arhgap21 UTSW 2 20892104 missense probably benign 0.10
R4232:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4233:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4234:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4235:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4236:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4434:Arhgap21 UTSW 2 20967335 missense probably benign
R4686:Arhgap21 UTSW 2 20863222 missense probably damaging 1.00
R4817:Arhgap21 UTSW 2 20850156 missense probably benign
R4834:Arhgap21 UTSW 2 20865319 missense probably damaging 1.00
R4845:Arhgap21 UTSW 2 20881187 missense probably damaging 0.99
R4904:Arhgap21 UTSW 2 20850061 missense probably benign 0.00
R4911:Arhgap21 UTSW 2 20858989 missense probably damaging 1.00
R4994:Arhgap21 UTSW 2 20849890 missense probably benign 0.00
R5067:Arhgap21 UTSW 2 20880037 missense probably damaging 1.00
R5086:Arhgap21 UTSW 2 20848834 missense probably benign 0.00
R5281:Arhgap21 UTSW 2 20849316 missense probably damaging 1.00
R5364:Arhgap21 UTSW 2 20849722 missense probably damaging 1.00
R5420:Arhgap21 UTSW 2 20881086 missense probably damaging 0.99
R5476:Arhgap21 UTSW 2 20880686 missense probably benign 0.06
R5831:Arhgap21 UTSW 2 20863213 missense probably damaging 1.00
R5949:Arhgap21 UTSW 2 20849041 missense probably damaging 0.97
R5994:Arhgap21 UTSW 2 20881376 missense possibly damaging 0.78
R6014:Arhgap21 UTSW 2 20881805 missense probably damaging 1.00
R6739:Arhgap21 UTSW 2 20880732 missense possibly damaging 0.94
R6817:Arhgap21 UTSW 2 20880296 missense probably benign 0.23
R6821:Arhgap21 UTSW 2 20848848 missense probably benign
R6844:Arhgap21 UTSW 2 20881305 missense probably benign 0.00
R6870:Arhgap21 UTSW 2 20880510 missense probably damaging 1.00
R6891:Arhgap21 UTSW 2 20850331 missense probably damaging 0.97
R7011:Arhgap21 UTSW 2 20848878 missense possibly damaging 0.65
R7144:Arhgap21 UTSW 2 20865387 missense probably benign
R7237:Arhgap21 UTSW 2 20849972 nonsense probably null
R7261:Arhgap21 UTSW 2 20880366 missense probably benign
R7558:Arhgap21 UTSW 2 20855610 missense probably damaging 1.00
R7566:Arhgap21 UTSW 2 20912291 missense probably benign 0.17
R7738:Arhgap21 UTSW 2 20849479 missense probably damaging 1.00
R7738:Arhgap21 UTSW 2 20850358 missense probably damaging 1.00
R7820:Arhgap21 UTSW 2 20863172 missense probably damaging 1.00
R7822:Arhgap21 UTSW 2 20880713 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGGACTGGTCTTGGCAGAAG -3'
(R):5'- GGCTCCCGTTGTTAATTCTGATAAC -3'

Sequencing Primer
(F):5'- TTGGCAGAAGTTCCTGGTAGACAC -3'
(R):5'- CCCGTTGTTAATTCTGATAACAGGCG -3'
Posted On2016-03-17