Incidental Mutation 'R4889:Cercam'
ID377180
Institutional Source Beutler Lab
Gene Symbol Cercam
Ensembl Gene ENSMUSG00000039787
Gene Namecerebral endothelial cell adhesion molecule
SynonymsCeecam1, CerCAM
MMRRC Submission 042494-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4889 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29869164-29882840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29881833 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 555 (D555G)
Ref Sequence ENSEMBL: ENSMUSP00000041622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047521]
Predicted Effect probably damaging
Transcript: ENSMUST00000047521
AA Change: D555G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041622
Gene: ENSMUSG00000039787
AA Change: D555G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 37 157 2.6e-15 PFAM
Pfam:Glyco_transf_25 316 500 3.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155355
Meta Mutation Damage Score 0.0880 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ado G C 10: 67,548,305 R157G probably benign Het
Akap12 C A 10: 4,356,535 A1115E probably damaging Het
Ankhd1 A G 18: 36,578,734 M196V probably null Het
Appl2 G A 10: 83,641,058 T34I probably damaging Het
Arhgap21 T C 2: 20,880,468 S472G probably benign Het
Asmt G T X: 170,677,029 R250L possibly damaging Het
Baz2b A T 2: 59,936,726 I870N probably damaging Het
Card11 T C 5: 140,885,945 Q667R possibly damaging Het
Cop1 A T 1: 159,284,589 R284S probably damaging Het
Cr2 A G 1: 195,176,585 V9A possibly damaging Het
Ctsm A G 13: 61,538,401 F106S probably damaging Het
Dhx9 A T 1: 153,481,149 L118Q probably damaging Het
Dnah5 G T 15: 28,235,792 C355F probably benign Het
Dock1 C A 7: 134,744,976 N212K probably benign Het
Efemp2 T A 19: 5,475,120 L18Q probably null Het
Flvcr1 A G 1: 191,025,567 L176P probably damaging Het
Gm16505 A T 13: 3,361,125 noncoding transcript Het
Gm6457 A T 18: 14,570,444 noncoding transcript Het
Gnptab A G 10: 88,433,913 N826S probably benign Het
Hdc T G 2: 126,594,133 N606T probably benign Het
Itga3 T C 11: 95,068,301 D113G probably benign Het
Maml3 C T 3: 51,694,510 probably benign Het
Mkrn1 A T 6: 39,420,005 probably benign Het
Myo18a T C 11: 77,832,412 V720A probably damaging Het
Nkx3-1 G A 14: 69,190,998 probably null Het
Npat T C 9: 53,562,207 I433T probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1024 C T 2: 85,904,748 C102Y possibly damaging Het
Olfr1115 A T 2: 87,252,647 I237F probably damaging Het
Olfr365 A G 2: 37,202,045 Y268C probably damaging Het
Pde6c T A 19: 38,133,151 M69K probably benign Het
Pde7b T C 10: 20,548,077 T18A probably benign Het
Plcz1 T C 6: 140,007,748 K381R probably benign Het
Ppfia4 A C 1: 134,300,514 F1095V probably damaging Het
Sfxn3 T C 19: 45,049,815 F78S probably damaging Het
Sim1 A T 10: 50,981,324 Y390F probably benign Het
Slc25a31 A G 3: 40,721,545 I174V probably benign Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slco1b2 T G 6: 141,656,743 probably benign Het
Smarca5 C A 8: 80,704,697 D964Y possibly damaging Het
Sptbn2 T A 19: 4,729,430 S338R possibly damaging Het
Srcap T C 7: 127,538,547 V1023A possibly damaging Het
Syt16 A G 12: 74,129,495 E46G probably damaging Het
Tas2r114 A T 6: 131,689,795 I90K probably damaging Het
Tlx1 G T 19: 45,150,979 D22Y probably damaging Het
Vamp8 G A 6: 72,385,539 L93F possibly damaging Het
Vill T C 9: 119,063,341 S347P possibly damaging Het
Zfp974 A G 7: 27,910,819 Y494H possibly damaging Het
Other mutations in Cercam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01885:Cercam APN 2 29881003 missense probably damaging 1.00
IGL02619:Cercam APN 2 29880674 missense probably benign 0.05
IGL03088:Cercam APN 2 29881687 splice site probably benign
I1329:Cercam UTSW 2 29871085 missense probably damaging 1.00
P0042:Cercam UTSW 2 29881083 missense probably damaging 1.00
R0086:Cercam UTSW 2 29871064 missense probably damaging 1.00
R0829:Cercam UTSW 2 29871067 missense probably damaging 0.98
R1442:Cercam UTSW 2 29880640 missense probably benign
R1558:Cercam UTSW 2 29876239 missense probably benign 0.35
R1997:Cercam UTSW 2 29872923 missense probably benign 0.11
R4678:Cercam UTSW 2 29869677 missense probably damaging 1.00
R4891:Cercam UTSW 2 29869271 unclassified probably benign
R4967:Cercam UTSW 2 29871021 critical splice acceptor site probably null
R5052:Cercam UTSW 2 29875627 missense probably damaging 1.00
R5541:Cercam UTSW 2 29875629 missense probably benign
R5650:Cercam UTSW 2 29881815 missense probably damaging 1.00
R7072:Cercam UTSW 2 29881924 missense probably benign 0.00
R7422:Cercam UTSW 2 29872880 missense possibly damaging 0.81
R7585:Cercam UTSW 2 29881731 missense probably damaging 1.00
R7725:Cercam UTSW 2 29872562 critical splice acceptor site probably null
R7730:Cercam UTSW 2 29872562 critical splice acceptor site probably null
R7747:Cercam UTSW 2 29871286 missense probably benign 0.02
RF016:Cercam UTSW 2 29869305 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGTTGGAGTCCACTTAAGAGTTC -3'
(R):5'- TCAGATGTAGAGATGTCAACAGC -3'

Sequencing Primer
(F):5'- GGAGTCCACTTAAGAGTTCTTCTC -3'
(R):5'- TGTAGAGATGTCAACAGCTATGG -3'
Posted On2016-03-17