Incidental Mutation 'R4889:Hdc'
ID 377185
Institutional Source Beutler Lab
Gene Symbol Hdc
Ensembl Gene ENSMUSG00000027360
Gene Name histidine decarboxylase
Synonyms Hdc-s, Hdc-a, L-histidine decarboxylase, Hdc-e, Hdc-c
MMRRC Submission 042494-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.854) question?
Stock # R4889 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 126435587-126461219 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 126436053 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 606 (N606T)
Ref Sequence ENSEMBL: ENSMUSP00000028838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028838]
AlphaFold P23738
Predicted Effect probably benign
Transcript: ENSMUST00000028838
AA Change: N606T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028838
Gene: ENSMUSG00000027360
AA Change: N606T

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Pyridoxal_deC 43 421 2.2e-173 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124396
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group II decarboxylase family and forms a homodimer that converts L-histidine to histamine in a pyridoxal phosphate dependent manner. Histamine regulates several physiologic processes, including neurotransmission, gastric acid secretion,inflamation, and smooth muscle tone.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mast cells, altered anxiety-related and nociceptive behavior, altered cognitive function, increased weight gain, visceral adiposity, increased amount of brown adipose tissue, impaired glucose tolerance, hyperinsulinemia, and hyperleptinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ado G C 10: 67,384,135 (GRCm39) R157G probably benign Het
Akap12 C A 10: 4,306,535 (GRCm39) A1115E probably damaging Het
Ankhd1 A G 18: 36,711,787 (GRCm39) M196V probably null Het
Appl2 G A 10: 83,476,922 (GRCm39) T34I probably damaging Het
Arhgap21 T C 2: 20,885,279 (GRCm39) S472G probably benign Het
Asmt G T X: 169,110,764 (GRCm39) R250L possibly damaging Het
Baz2b A T 2: 59,767,070 (GRCm39) I870N probably damaging Het
Card11 T C 5: 140,871,700 (GRCm39) Q667R possibly damaging Het
Cercam A G 2: 29,771,845 (GRCm39) D555G probably damaging Het
Cop1 A T 1: 159,112,159 (GRCm39) R284S probably damaging Het
Cr2 A G 1: 194,858,893 (GRCm39) V9A possibly damaging Het
Ctsm A G 13: 61,686,215 (GRCm39) F106S probably damaging Het
Dhx9 A T 1: 153,356,895 (GRCm39) L118Q probably damaging Het
Dnah5 G T 15: 28,235,938 (GRCm39) C355F probably benign Het
Dock1 C A 7: 134,346,705 (GRCm39) N212K probably benign Het
Efemp2 T A 19: 5,525,148 (GRCm39) L18Q probably null Het
Flvcr1 A G 1: 190,757,764 (GRCm39) L176P probably damaging Het
Gm16505 A T 13: 3,411,125 (GRCm39) noncoding transcript Het
Gm6457 A T 18: 14,703,501 (GRCm39) noncoding transcript Het
Gnptab A G 10: 88,269,775 (GRCm39) N826S probably benign Het
Itga3 T C 11: 94,959,127 (GRCm39) D113G probably benign Het
Maml3 C T 3: 51,601,931 (GRCm39) probably benign Het
Mkrn1 A T 6: 39,396,939 (GRCm39) probably benign Het
Myo18a T C 11: 77,723,238 (GRCm39) V720A probably damaging Het
Nkx3-1 G A 14: 69,428,447 (GRCm39) probably null Het
Npat T C 9: 53,473,507 (GRCm39) I433T probably benign Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or10ag53 A T 2: 87,082,991 (GRCm39) I237F probably damaging Het
Or1l4 A G 2: 37,092,057 (GRCm39) Y268C probably damaging Het
Or5m12 C T 2: 85,735,092 (GRCm39) C102Y possibly damaging Het
Pde6c T A 19: 38,121,599 (GRCm39) M69K probably benign Het
Pde7b T C 10: 20,423,823 (GRCm39) T18A probably benign Het
Plcz1 T C 6: 139,953,474 (GRCm39) K381R probably benign Het
Ppfia4 A C 1: 134,228,252 (GRCm39) F1095V probably damaging Het
Sfxn3 T C 19: 45,038,254 (GRCm39) F78S probably damaging Het
Sim1 A T 10: 50,857,420 (GRCm39) Y390F probably benign Het
Slc25a31 A G 3: 40,675,975 (GRCm39) I174V probably benign Het
Slc5a9 C A 4: 111,748,941 (GRCm39) probably null Het
Slco1b2 T G 6: 141,602,469 (GRCm39) probably benign Het
Smarca5 C A 8: 81,431,326 (GRCm39) D964Y possibly damaging Het
Sptbn2 T A 19: 4,779,458 (GRCm39) S338R possibly damaging Het
Srcap T C 7: 127,137,719 (GRCm39) V1023A possibly damaging Het
Syt16 A G 12: 74,176,269 (GRCm39) E46G probably damaging Het
Tas2r114 A T 6: 131,666,758 (GRCm39) I90K probably damaging Het
Tlx1 G T 19: 45,139,418 (GRCm39) D22Y probably damaging Het
Vamp8 G A 6: 72,362,522 (GRCm39) L93F possibly damaging Het
Vill T C 9: 118,892,409 (GRCm39) S347P possibly damaging Het
Zfp974 A G 7: 27,610,244 (GRCm39) Y494H possibly damaging Het
Other mutations in Hdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Hdc APN 2 126,443,792 (GRCm39) missense probably benign 0.00
IGL01024:Hdc APN 2 126,445,766 (GRCm39) missense probably benign 0.32
IGL01393:Hdc APN 2 126,436,581 (GRCm39) missense probably benign 0.28
IGL01802:Hdc APN 2 126,445,814 (GRCm39) missense probably benign 0.04
IGL01958:Hdc APN 2 126,436,452 (GRCm39) missense possibly damaging 0.87
IGL02193:Hdc APN 2 126,443,700 (GRCm39) splice site probably benign
IGL02494:Hdc APN 2 126,436,041 (GRCm39) missense probably benign
IGL02696:Hdc APN 2 126,436,220 (GRCm39) missense probably damaging 1.00
IGL02874:Hdc APN 2 126,443,596 (GRCm39) missense probably benign 0.21
R0453:Hdc UTSW 2 126,436,871 (GRCm39) splice site probably benign
R0528:Hdc UTSW 2 126,458,152 (GRCm39) missense probably benign 0.00
R1337:Hdc UTSW 2 126,458,196 (GRCm39) missense probably benign
R1862:Hdc UTSW 2 126,439,853 (GRCm39) missense probably benign 0.36
R1938:Hdc UTSW 2 126,448,317 (GRCm39) missense possibly damaging 0.86
R1994:Hdc UTSW 2 126,458,107 (GRCm39) missense probably damaging 1.00
R2230:Hdc UTSW 2 126,435,938 (GRCm39) missense possibly damaging 0.65
R2257:Hdc UTSW 2 126,458,000 (GRCm39) splice site probably null
R2921:Hdc UTSW 2 126,435,910 (GRCm39) missense probably damaging 1.00
R2923:Hdc UTSW 2 126,435,910 (GRCm39) missense probably damaging 1.00
R3620:Hdc UTSW 2 126,458,187 (GRCm39) missense possibly damaging 0.86
R3621:Hdc UTSW 2 126,458,187 (GRCm39) missense possibly damaging 0.86
R3914:Hdc UTSW 2 126,444,926 (GRCm39) missense probably damaging 1.00
R4076:Hdc UTSW 2 126,458,181 (GRCm39) missense possibly damaging 0.92
R4114:Hdc UTSW 2 126,443,738 (GRCm39) missense probably benign 0.16
R4213:Hdc UTSW 2 126,439,786 (GRCm39) splice site probably null
R4827:Hdc UTSW 2 126,436,233 (GRCm39) missense probably benign
R5013:Hdc UTSW 2 126,446,220 (GRCm39) missense probably benign 0.33
R5593:Hdc UTSW 2 126,460,504 (GRCm39) utr 5 prime probably benign
R5604:Hdc UTSW 2 126,436,583 (GRCm39) missense probably benign
R5637:Hdc UTSW 2 126,458,109 (GRCm39) missense probably benign 0.02
R6211:Hdc UTSW 2 126,435,897 (GRCm39) missense probably damaging 0.98
R6312:Hdc UTSW 2 126,449,326 (GRCm39) missense possibly damaging 0.65
R7730:Hdc UTSW 2 126,436,002 (GRCm39) missense possibly damaging 0.51
R7889:Hdc UTSW 2 126,458,130 (GRCm39) missense probably damaging 1.00
R8328:Hdc UTSW 2 126,443,803 (GRCm39) missense probably damaging 1.00
R8482:Hdc UTSW 2 126,436,125 (GRCm39) missense probably benign
R8517:Hdc UTSW 2 126,439,890 (GRCm39) critical splice acceptor site probably null
R9136:Hdc UTSW 2 126,439,786 (GRCm39) splice site probably null
R9139:Hdc UTSW 2 126,439,837 (GRCm39) missense probably damaging 1.00
R9208:Hdc UTSW 2 126,436,600 (GRCm39) missense probably benign 0.32
R9515:Hdc UTSW 2 126,458,149 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTCTTGCATTCTGATTGAGGACTC -3'
(R):5'- CGGCTCTGATCTGGAAACGATG -3'

Sequencing Primer
(F):5'- CTGATTGAGGACTCTACACCATGG -3'
(R):5'- AAACGATGCCGGATCCCTTTG -3'
Posted On 2016-03-17