Incidental Mutation 'R4889:Slc5a9'
ID377188
Institutional Source Beutler Lab
Gene Symbol Slc5a9
Ensembl Gene ENSMUSG00000028544
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 9
SynonymsSGLT4
MMRRC Submission 042494-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4889 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location111875375-111902918 bp(-) (GRCm38)
Type of Mutationintron (43 bp from exon)
DNA Base Change (assembly) C to A at 111891744 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102719] [ENSMUST00000102720] [ENSMUST00000102721] [ENSMUST00000128340]
Predicted Effect probably null
Transcript: ENSMUST00000102719
SMART Domains Protein: ENSMUSP00000099780
Gene: ENSMUSG00000028544

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102720
SMART Domains Protein: ENSMUSP00000099781
Gene: ENSMUSG00000028544

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102721
SMART Domains Protein: ENSMUSP00000099782
Gene: ENSMUSG00000028544

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128340
SMART Domains Protein: ENSMUSP00000120546
Gene: ENSMUSG00000028544

DomainStartEndE-ValueType
Pfam:SSF 23 255 9.3e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149922
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ado G C 10: 67,548,305 R157G probably benign Het
Akap12 C A 10: 4,356,535 A1115E probably damaging Het
Ankhd1 A G 18: 36,578,734 M196V probably null Het
Appl2 G A 10: 83,641,058 T34I probably damaging Het
Arhgap21 T C 2: 20,880,468 S472G probably benign Het
Asmt G T X: 170,677,029 R250L possibly damaging Het
Baz2b A T 2: 59,936,726 I870N probably damaging Het
Card11 T C 5: 140,885,945 Q667R possibly damaging Het
Cercam A G 2: 29,881,833 D555G probably damaging Het
Cop1 A T 1: 159,284,589 R284S probably damaging Het
Cr2 A G 1: 195,176,585 V9A possibly damaging Het
Ctsm A G 13: 61,538,401 F106S probably damaging Het
Dhx9 A T 1: 153,481,149 L118Q probably damaging Het
Dnah5 G T 15: 28,235,792 C355F probably benign Het
Dock1 C A 7: 134,744,976 N212K probably benign Het
Efemp2 T A 19: 5,475,120 L18Q probably null Het
Flvcr1 A G 1: 191,025,567 L176P probably damaging Het
Gm16505 A T 13: 3,361,125 noncoding transcript Het
Gm6457 A T 18: 14,570,444 noncoding transcript Het
Gnptab A G 10: 88,433,913 N826S probably benign Het
Hdc T G 2: 126,594,133 N606T probably benign Het
Itga3 T C 11: 95,068,301 D113G probably benign Het
Maml3 C T 3: 51,694,510 probably benign Het
Mkrn1 A T 6: 39,420,005 probably benign Het
Myo18a T C 11: 77,832,412 V720A probably damaging Het
Nkx3-1 G A 14: 69,190,998 probably null Het
Npat T C 9: 53,562,207 I433T probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1024 C T 2: 85,904,748 C102Y possibly damaging Het
Olfr1115 A T 2: 87,252,647 I237F probably damaging Het
Olfr365 A G 2: 37,202,045 Y268C probably damaging Het
Pde6c T A 19: 38,133,151 M69K probably benign Het
Pde7b T C 10: 20,548,077 T18A probably benign Het
Plcz1 T C 6: 140,007,748 K381R probably benign Het
Ppfia4 A C 1: 134,300,514 F1095V probably damaging Het
Sfxn3 T C 19: 45,049,815 F78S probably damaging Het
Sim1 A T 10: 50,981,324 Y390F probably benign Het
Slc25a31 A G 3: 40,721,545 I174V probably benign Het
Slco1b2 T G 6: 141,656,743 probably benign Het
Smarca5 C A 8: 80,704,697 D964Y possibly damaging Het
Sptbn2 T A 19: 4,729,430 S338R possibly damaging Het
Srcap T C 7: 127,538,547 V1023A possibly damaging Het
Syt16 A G 12: 74,129,495 E46G probably damaging Het
Tas2r114 A T 6: 131,689,795 I90K probably damaging Het
Tlx1 G T 19: 45,150,979 D22Y probably damaging Het
Vamp8 G A 6: 72,385,539 L93F possibly damaging Het
Vill T C 9: 119,063,341 S347P possibly damaging Het
Zfp974 A G 7: 27,910,819 Y494H possibly damaging Het
Other mutations in Slc5a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Slc5a9 APN 4 111898569 missense probably damaging 0.99
IGL00837:Slc5a9 APN 4 111893690 intron probably benign
IGL01556:Slc5a9 APN 4 111898636 missense probably benign 0.00
IGL01807:Slc5a9 APN 4 111877540 makesense probably null
IGL01816:Slc5a9 APN 4 111898614 missense probably damaging 1.00
IGL02066:Slc5a9 APN 4 111887522 missense probably damaging 1.00
IGL02370:Slc5a9 APN 4 111877629 missense probably benign 0.01
IGL02491:Slc5a9 APN 4 111896352 missense probably damaging 0.99
IGL02971:Slc5a9 APN 4 111890300 missense possibly damaging 0.58
IGL03008:Slc5a9 APN 4 111890941 missense probably benign 0.14
R0365:Slc5a9 UTSW 4 111891836 nonsense probably null
R0559:Slc5a9 UTSW 4 111885582 missense probably benign 0.02
R0659:Slc5a9 UTSW 4 111883871 missense possibly damaging 0.82
R1454:Slc5a9 UTSW 4 111883964 missense probably benign 0.04
R2006:Slc5a9 UTSW 4 111880226 missense probably benign
R2014:Slc5a9 UTSW 4 111896349 missense possibly damaging 0.76
R2024:Slc5a9 UTSW 4 111890531 missense probably damaging 1.00
R2076:Slc5a9 UTSW 4 111885573 missense possibly damaging 0.76
R2152:Slc5a9 UTSW 4 111893223 missense possibly damaging 0.76
R3156:Slc5a9 UTSW 4 111890224 missense possibly damaging 0.80
R4566:Slc5a9 UTSW 4 111891744 intron probably null
R4568:Slc5a9 UTSW 4 111891744 intron probably null
R4579:Slc5a9 UTSW 4 111893187 missense probably damaging 1.00
R4656:Slc5a9 UTSW 4 111891744 intron probably null
R4657:Slc5a9 UTSW 4 111891744 intron probably null
R4700:Slc5a9 UTSW 4 111890937 missense possibly damaging 0.64
R4891:Slc5a9 UTSW 4 111891744 intron probably null
R4911:Slc5a9 UTSW 4 111891744 intron probably null
R4948:Slc5a9 UTSW 4 111891744 intron probably null
R4953:Slc5a9 UTSW 4 111891744 intron probably null
R5222:Slc5a9 UTSW 4 111898611 missense possibly damaging 0.55
R5376:Slc5a9 UTSW 4 111893217 missense possibly damaging 0.80
R5502:Slc5a9 UTSW 4 111893169 nonsense probably null
R5851:Slc5a9 UTSW 4 111885600 missense probably benign
R6030:Slc5a9 UTSW 4 111885528 missense possibly damaging 0.64
R6030:Slc5a9 UTSW 4 111885528 missense possibly damaging 0.64
R6125:Slc5a9 UTSW 4 111883805 missense probably damaging 1.00
R6326:Slc5a9 UTSW 4 111880253 missense probably benign
R6438:Slc5a9 UTSW 4 111891825 missense probably benign 0.00
R7105:Slc5a9 UTSW 4 111898695 missense probably benign
R7166:Slc5a9 UTSW 4 111883839 missense probably benign 0.04
R7489:Slc5a9 UTSW 4 111883916 missense probably damaging 1.00
R7599:Slc5a9 UTSW 4 111877740 missense probably benign
R7662:Slc5a9 UTSW 4 111877540 makesense probably null
R7762:Slc5a9 UTSW 4 111890174 missense probably damaging 0.99
X0012:Slc5a9 UTSW 4 111893314 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTACAACTCATCCTCAGCAGG -3'
(R):5'- GGGTGCTGACTTTCTACAGAC -3'

Sequencing Primer
(F):5'- AGCAGGACCCCATGTCTCTC -3'
(R):5'- ACAGACTGATATCTTCTCTGGAGC -3'
Posted On2016-03-17