Mutagenetix > Incidental Mutation

Incidental Mutation 'R4889:Vill'

377201

Institutional Source

Beutler Lab

Gene Symbol

Vill

Ensembl Gene

ENSMUSG00000038775

Gene Name

villin-like

Synonyms

Villp

MMRRC Submission

042494-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R4889 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119052778-119071525 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119063341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 347 (S347P)

Ref Sequence

ENSEMBL: ENSMUSP00000074294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000131647] [ENSMUST00000136561] [ENSMUST00000141185]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000051386
AA Change: S347P

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775
AA Change: S347P

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
GEL	613	706	7.8e-16	SMART
VHP	824	859	2.12e-17	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074734
AA Change: S347P

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775
AA Change: S347P

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
VHP	740	775	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000126251

SMART Domains

Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
Blast:GEL	1	56	9e-21	BLAST
GEL	63	149	4.38e-19	SMART
GEL	168	261	7.8e-16	SMART
VHP	357	392	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131647

SMART Domains

Protein: ENSMUSP00000118375
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
SCOP:d1d4xg_	7	85	6e-23	SMART
Blast:GEL	14	85	1e-48	BLAST
PDB:2VIL\|A	15	82	1e-15	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000136561

SMART Domains

Protein: ENSMUSP00000123393
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
GEL	1	96	2.46e-13	SMART
Blast:GEL	116	140	2e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000141185

SMART Domains

Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
GEL	7	104	7.92e-17	SMART
GEL	124	210	4.38e-19	SMART
GEL	229	322	7.8e-16	SMART
VHP	440	475	2.12e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151638

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153454

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153630

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ado	G	C	10: 67,548,305	R157G	probably benign	Het
Akap12	C	A	10: 4,356,535	A1115E	probably damaging	Het
Ankhd1	A	G	18: 36,578,734	M196V	probably null	Het
Appl2	G	A	10: 83,641,058	T34I	probably damaging	Het
Arhgap21	T	C	2: 20,880,468	S472G	probably benign	Het
Asmt	G	T	X: 170,677,029	R250L	possibly damaging	Het
Baz2b	A	T	2: 59,936,726	I870N	probably damaging	Het
Card11	T	C	5: 140,885,945	Q667R	possibly damaging	Het
Cercam	A	G	2: 29,881,833	D555G	probably damaging	Het
Cop1	A	T	1: 159,284,589	R284S	probably damaging	Het
Cr2	A	G	1: 195,176,585	V9A	possibly damaging	Het
Ctsm	A	G	13: 61,538,401	F106S	probably damaging	Het
Dhx9	A	T	1: 153,481,149	L118Q	probably damaging	Het
Dnah5	G	T	15: 28,235,792	C355F	probably benign	Het
Dock1	C	A	7: 134,744,976	N212K	probably benign	Het
Efemp2	T	A	19: 5,475,120	L18Q	probably null	Het
Flvcr1	A	G	1: 191,025,567	L176P	probably damaging	Het
Gm16505	A	T	13: 3,361,125		noncoding transcript	Het
Gm6457	A	T	18: 14,570,444		noncoding transcript	Het
Gnptab	A	G	10: 88,433,913	N826S	probably benign	Het
Hdc	T	G	2: 126,594,133	N606T	probably benign	Het
Itga3	T	C	11: 95,068,301	D113G	probably benign	Het
Maml3	C	T	3: 51,694,510		probably benign	Het
Mkrn1	A	T	6: 39,420,005		probably benign	Het
Myo18a	T	C	11: 77,832,412	V720A	probably damaging	Het
Nkx3-1	G	A	14: 69,190,998		probably null	Het
Npat	T	C	9: 53,562,207	I433T	probably benign	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr1024	C	T	2: 85,904,748	C102Y	possibly damaging	Het
Olfr1115	A	T	2: 87,252,647	I237F	probably damaging	Het
Olfr365	A	G	2: 37,202,045	Y268C	probably damaging	Het
Pde6c	T	A	19: 38,133,151	M69K	probably benign	Het
Pde7b	T	C	10: 20,548,077	T18A	probably benign	Het
Plcz1	T	C	6: 140,007,748	K381R	probably benign	Het
Ppfia4	A	C	1: 134,300,514	F1095V	probably damaging	Het
Sfxn3	T	C	19: 45,049,815	F78S	probably damaging	Het
Sim1	A	T	10: 50,981,324	Y390F	probably benign	Het
Slc25a31	A	G	3: 40,721,545	I174V	probably benign	Het
Slc5a9	C	A	4: 111,891,744		probably null	Het
Slco1b2	T	G	6: 141,656,743		probably benign	Het
Smarca5	C	A	8: 80,704,697	D964Y	possibly damaging	Het
Sptbn2	T	A	19: 4,729,430	S338R	possibly damaging	Het
Srcap	T	C	7: 127,538,547	V1023A	possibly damaging	Het
Syt16	A	G	12: 74,129,495	E46G	probably damaging	Het
Tas2r114	A	T	6: 131,689,795	I90K	probably damaging	Het
Tlx1	G	T	19: 45,150,979	D22Y	probably damaging	Het
Vamp8	G	A	6: 72,385,539	L93F	possibly damaging	Het
Zfp974	A	G	7: 27,910,819	Y494H	possibly damaging	Het

Other mutations in Vill

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Vill	APN	9	119063312	missense	probably damaging	1.00
IGL01024:Vill	APN	9	119070350	critical splice donor site	probably null
IGL01934:Vill	APN	9	119066809	missense	probably damaging	1.00
IGL02118:Vill	APN	9	119060398	missense	probably benign	0.44
IGL02260:Vill	APN	9	119058441	missense	probably benign	0.00
IGL02507:Vill	APN	9	119070777	missense	possibly damaging	0.86
IGL02870:Vill	APN	9	119061899	missense	probably damaging	1.00
IGL02941:Vill	APN	9	119066887	unclassified	probably benign
IGL02835:Vill	UTSW	9	119067445	missense	probably benign	0.11
R0285:Vill	UTSW	9	119070827	unclassified	probably benign
R0571:Vill	UTSW	9	119070633	missense	possibly damaging	0.93
R1024:Vill	UTSW	9	119066824	missense	probably damaging	1.00
R1168:Vill	UTSW	9	119070321	missense	probably damaging	0.99
R1374:Vill	UTSW	9	119061494	missense	probably benign	0.03
R1400:Vill	UTSW	9	119063347	missense	probably benign	0.01
R1551:Vill	UTSW	9	119063372	missense	probably benign
R1584:Vill	UTSW	9	119065586	missense	probably damaging	1.00
R1630:Vill	UTSW	9	119070701	missense	probably benign	0.37
R1721:Vill	UTSW	9	119066014	missense	probably damaging	0.98
R1946:Vill	UTSW	9	119058492	missense	probably benign
R2311:Vill	UTSW	9	119065897	missense	probably benign	0.08
R2392:Vill	UTSW	9	119067560	unclassified	probably benign
R2509:Vill	UTSW	9	119070302	missense	possibly damaging	0.84
R2760:Vill	UTSW	9	119066882	critical splice donor site	probably null
R3886:Vill	UTSW	9	119066714	missense	probably benign	0.24
R3944:Vill	UTSW	9	119068431	missense	probably benign	0.10
R4245:Vill	UTSW	9	119071291	unclassified	probably benign
R4246:Vill	UTSW	9	119060393	missense	probably damaging	1.00
R4771:Vill	UTSW	9	119068434	missense	probably damaging	1.00
R4932:Vill	UTSW	9	119061511	missense	probably damaging	1.00
R4946:Vill	UTSW	9	119068440	missense	probably damaging	1.00
R5121:Vill	UTSW	9	119070025	missense	possibly damaging	0.92
R5646:Vill	UTSW	9	119071162	missense	probably damaging	1.00
R6089:Vill	UTSW	9	119057799	missense	probably benign	0.00
R6149:Vill	UTSW	9	119058414	missense	possibly damaging	0.67
R6167:Vill	UTSW	9	119066864	missense	probably damaging	0.98
R6318:Vill	UTSW	9	119063648	missense	probably benign	0.15
R6319:Vill	UTSW	9	119063648	missense	probably benign	0.15
R6590:Vill	UTSW	9	119061907	missense	probably benign	0.04
R6690:Vill	UTSW	9	119061907	missense	probably benign	0.04
R6889:Vill	UTSW	9	119065882	missense	possibly damaging	0.58
R7207:Vill	UTSW	9	119071213	missense	possibly damaging	0.64
R7353:Vill	UTSW	9	119065493	missense	probably damaging	0.99
R7398:Vill	UTSW	9	119070648	missense	probably benign	0.26
R7883:Vill	UTSW	9	119065521	nonsense	probably null
R8165:Vill	UTSW	9	119066753	missense	probably damaging	0.98
R8281:Vill	UTSW	9	119058479	missense	probably damaging	1.00
R8380:Vill	UTSW	9	119057849	missense	probably benign	0.04
R8685:Vill	UTSW	9	119066727	missense	probably benign	0.00
R8847:Vill	UTSW	9	119068446	missense	probably damaging	0.99
R8968:Vill	UTSW	9	119063603	critical splice donor site	probably null
R9290:Vill	UTSW	9	119061494	missense	probably benign	0.03
RF005:Vill	UTSW	9	119060439	missense	probably damaging	1.00
Z1176:Vill	UTSW	9	119069965	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGCTTGGGCATCCTTGTG -3'
(R):5'- TGATGTTCTTCAGGACCACC -3'

Sequencing Primer
(F):5'- CATCCTTGTGGCCACGGTTG -3'
(R):5'- ATCTCACAGGGTCCCGGAC -3'

Posted On

2016-03-17