Incidental Mutation 'R4889:Appl2'
ID 377204
Institutional Source Beutler Lab
Gene Symbol Appl2
Ensembl Gene ENSMUSG00000020263
Gene Name adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Synonyms Dip3b
MMRRC Submission 042494-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4889 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 83435897-83484602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 83476922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 34 (T34I)
Ref Sequence ENSEMBL: ENSMUSP00000135645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020500] [ENSMUST00000146876] [ENSMUST00000150685] [ENSMUST00000176294]
AlphaFold Q8K3G9
Predicted Effect probably damaging
Transcript: ENSMUST00000020500
AA Change: T34I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020500
Gene: ENSMUSG00000020263
AA Change: T34I

DomainStartEndE-ValueType
Pfam:BAR_3 7 248 6.4e-69 PFAM
PH 278 377 1.2e-7 SMART
Pfam:PTB 491 613 6e-7 PFAM
Pfam:PID 492 611 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133719
Predicted Effect probably damaging
Transcript: ENSMUST00000146876
AA Change: T34I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121336
Gene: ENSMUSG00000020263
AA Change: T34I

DomainStartEndE-ValueType
PDB:4H8S|D 2 209 1e-141 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147582
Predicted Effect probably damaging
Transcript: ENSMUST00000150685
AA Change: T34I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115903
Gene: ENSMUSG00000020263
AA Change: T34I

DomainStartEndE-ValueType
PDB:4H8S|D 2 95 4e-59 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000176294
AA Change: T34I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135645
Gene: ENSMUSG00000020263
AA Change: T34I

DomainStartEndE-ValueType
PDB:4H8S|D 2 95 1e-53 PDB
Meta Mutation Damage Score 0.3851 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two effectors of the small GTPase RAB5A/Rab5, which are involved in a signal transduction pathway. Both effectors contain an N-terminal Bin/Amphiphysin/Rvs (BAR) domain, a central pleckstrin homology (PH) domain, and a C-terminal phosphotyrosine binding (PTB) domain, and they bind the Rab5 through the BAR domain. They are associated with endosomal membranes and can be translocated to the nucleus in response to the EGF stimulus. They interact with the NuRD/MeCP1 complex (nucleosome remodeling and deacetylase /methyl-CpG-binding protein 1 complex) and are required for efficient cell proliferation. A chromosomal aberration t(12;22)(q24.1;q13.3) involving this gene and the PSAP2 gene results in 22q13.3 deletion syndrome, also known as Phelan-McDermid syndrome. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele display altered red blood cell physiology. Mutant MEFs exhibit defects in HGF-induced Akt activation, migration, and invasion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ado G C 10: 67,384,135 (GRCm39) R157G probably benign Het
Akap12 C A 10: 4,306,535 (GRCm39) A1115E probably damaging Het
Ankhd1 A G 18: 36,711,787 (GRCm39) M196V probably null Het
Arhgap21 T C 2: 20,885,279 (GRCm39) S472G probably benign Het
Asmt G T X: 169,110,764 (GRCm39) R250L possibly damaging Het
Baz2b A T 2: 59,767,070 (GRCm39) I870N probably damaging Het
Card11 T C 5: 140,871,700 (GRCm39) Q667R possibly damaging Het
Cercam A G 2: 29,771,845 (GRCm39) D555G probably damaging Het
Cop1 A T 1: 159,112,159 (GRCm39) R284S probably damaging Het
Cr2 A G 1: 194,858,893 (GRCm39) V9A possibly damaging Het
Ctsm A G 13: 61,686,215 (GRCm39) F106S probably damaging Het
Dhx9 A T 1: 153,356,895 (GRCm39) L118Q probably damaging Het
Dnah5 G T 15: 28,235,938 (GRCm39) C355F probably benign Het
Dock1 C A 7: 134,346,705 (GRCm39) N212K probably benign Het
Efemp2 T A 19: 5,525,148 (GRCm39) L18Q probably null Het
Flvcr1 A G 1: 190,757,764 (GRCm39) L176P probably damaging Het
Gm16505 A T 13: 3,411,125 (GRCm39) noncoding transcript Het
Gm6457 A T 18: 14,703,501 (GRCm39) noncoding transcript Het
Gnptab A G 10: 88,269,775 (GRCm39) N826S probably benign Het
Hdc T G 2: 126,436,053 (GRCm39) N606T probably benign Het
Itga3 T C 11: 94,959,127 (GRCm39) D113G probably benign Het
Maml3 C T 3: 51,601,931 (GRCm39) probably benign Het
Mkrn1 A T 6: 39,396,939 (GRCm39) probably benign Het
Myo18a T C 11: 77,723,238 (GRCm39) V720A probably damaging Het
Nkx3-1 G A 14: 69,428,447 (GRCm39) probably null Het
Npat T C 9: 53,473,507 (GRCm39) I433T probably benign Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or10ag53 A T 2: 87,082,991 (GRCm39) I237F probably damaging Het
Or1l4 A G 2: 37,092,057 (GRCm39) Y268C probably damaging Het
Or5m12 C T 2: 85,735,092 (GRCm39) C102Y possibly damaging Het
Pde6c T A 19: 38,121,599 (GRCm39) M69K probably benign Het
Pde7b T C 10: 20,423,823 (GRCm39) T18A probably benign Het
Plcz1 T C 6: 139,953,474 (GRCm39) K381R probably benign Het
Ppfia4 A C 1: 134,228,252 (GRCm39) F1095V probably damaging Het
Sfxn3 T C 19: 45,038,254 (GRCm39) F78S probably damaging Het
Sim1 A T 10: 50,857,420 (GRCm39) Y390F probably benign Het
Slc25a31 A G 3: 40,675,975 (GRCm39) I174V probably benign Het
Slc5a9 C A 4: 111,748,941 (GRCm39) probably null Het
Slco1b2 T G 6: 141,602,469 (GRCm39) probably benign Het
Smarca5 C A 8: 81,431,326 (GRCm39) D964Y possibly damaging Het
Sptbn2 T A 19: 4,779,458 (GRCm39) S338R possibly damaging Het
Srcap T C 7: 127,137,719 (GRCm39) V1023A possibly damaging Het
Syt16 A G 12: 74,176,269 (GRCm39) E46G probably damaging Het
Tas2r114 A T 6: 131,666,758 (GRCm39) I90K probably damaging Het
Tlx1 G T 19: 45,139,418 (GRCm39) D22Y probably damaging Het
Vamp8 G A 6: 72,362,522 (GRCm39) L93F possibly damaging Het
Vill T C 9: 118,892,409 (GRCm39) S347P possibly damaging Het
Zfp974 A G 7: 27,610,244 (GRCm39) Y494H possibly damaging Het
Other mutations in Appl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Appl2 APN 10 83,450,165 (GRCm39) missense possibly damaging 0.95
IGL01794:Appl2 APN 10 83,450,158 (GRCm39) missense probably benign
IGL01887:Appl2 APN 10 83,457,386 (GRCm39) unclassified probably benign
IGL03071:Appl2 APN 10 83,476,970 (GRCm39) critical splice acceptor site probably null
IGL03077:Appl2 APN 10 83,457,623 (GRCm39) unclassified probably benign
R0006:Appl2 UTSW 10 83,438,762 (GRCm39) missense probably damaging 1.00
R0006:Appl2 UTSW 10 83,438,762 (GRCm39) missense probably damaging 1.00
R0591:Appl2 UTSW 10 83,460,509 (GRCm39) missense possibly damaging 0.94
R1695:Appl2 UTSW 10 83,457,446 (GRCm39) missense probably damaging 0.99
R2217:Appl2 UTSW 10 83,444,601 (GRCm39) missense possibly damaging 0.47
R2218:Appl2 UTSW 10 83,444,601 (GRCm39) missense possibly damaging 0.47
R4782:Appl2 UTSW 10 83,436,855 (GRCm39) missense probably damaging 1.00
R5109:Appl2 UTSW 10 83,436,871 (GRCm39) missense probably benign 0.06
R5460:Appl2 UTSW 10 83,438,696 (GRCm39) missense probably benign 0.00
R5512:Appl2 UTSW 10 83,441,682 (GRCm39) missense probably damaging 1.00
R6023:Appl2 UTSW 10 83,484,393 (GRCm39) missense probably null 0.00
R6047:Appl2 UTSW 10 83,448,765 (GRCm39) critical splice acceptor site probably null
R7403:Appl2 UTSW 10 83,450,059 (GRCm39) missense probably benign 0.00
R7537:Appl2 UTSW 10 83,453,292 (GRCm39) missense possibly damaging 0.69
R8488:Appl2 UTSW 10 83,446,866 (GRCm39) missense probably benign 0.02
R9203:Appl2 UTSW 10 83,476,879 (GRCm39) nonsense probably null
X0027:Appl2 UTSW 10 83,457,418 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGTATAGGGGCCCACATAC -3'
(R):5'- CCTGGTAGAAAGAATGAGCTCC -3'

Sequencing Primer
(F):5'- TAGCACGATACTGTGCCTAGC -3'
(R):5'- GAATGAGCTCCAGACACTTTCC -3'
Posted On 2016-03-17