Incidental Mutation 'R4890:Itga8'
ID 377233
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 042495-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R4890 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 12198102 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect probably benign
Transcript: ENSMUST00000028106
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129370
Predicted Effect probably benign
Transcript: ENSMUST00000172791
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T C 1: 130,668,725 (GRCm39) probably benign Het
Adcy4 C T 14: 56,016,486 (GRCm39) D322N probably damaging Het
Adgrb3 T C 1: 25,260,908 (GRCm39) N916S probably damaging Het
Aox1 T C 1: 58,373,862 (GRCm39) V841A probably benign Het
Baz2b A T 2: 59,756,383 (GRCm39) M983K probably damaging Het
C2cd2l A G 9: 44,222,430 (GRCm39) F682L probably damaging Het
Ccsap T G 8: 124,572,160 (GRCm39) E114A possibly damaging Het
Cept1 T A 3: 106,413,123 (GRCm39) T201S probably damaging Het
Cfap221 T C 1: 119,883,476 (GRCm39) M232V probably benign Het
Chsy1 A G 7: 65,759,974 (GRCm39) R106G probably benign Het
Cit C T 5: 116,126,182 (GRCm39) probably benign Het
Cldn7 G A 11: 69,857,918 (GRCm39) V42I probably benign Het
Cnnm4 T A 1: 36,511,345 (GRCm39) V191E probably benign Het
Cntf A T 19: 12,741,326 (GRCm39) V178D possibly damaging Het
Ctsz C A 2: 174,270,393 (GRCm39) R263L probably damaging Het
Dclk1 T C 3: 55,429,353 (GRCm39) M407T probably benign Het
Dennd1a A T 2: 38,066,238 (GRCm39) probably benign Het
Dnhd1 A G 7: 105,306,164 (GRCm39) I368V possibly damaging Het
Gak A T 5: 108,728,742 (GRCm39) probably benign Het
Hepacam2 A T 6: 3,487,231 (GRCm39) V42D probably damaging Het
Il1rl2 CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT CTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT 1: 40,366,470 (GRCm39) probably benign Het
Insr T A 8: 3,248,234 (GRCm39) Q437L probably benign Het
Kansl1 A T 11: 104,233,868 (GRCm39) C732S probably benign Het
Kdsr T C 1: 106,680,964 (GRCm39) K78R probably benign Het
Kif14 T C 1: 136,414,868 (GRCm39) S785P possibly damaging Het
Lbr C A 1: 181,645,133 (GRCm39) L506F probably benign Het
Macf1 C A 4: 123,342,031 (GRCm39) C2720F probably damaging Het
Mapt G A 11: 104,218,975 (GRCm39) D738N probably damaging Het
Mroh9 T C 1: 162,854,093 (GRCm39) Y769C probably damaging Het
Mylk2 A G 2: 152,762,274 (GRCm39) N515S possibly damaging Het
Myorg G A 4: 41,498,877 (GRCm39) T251M probably benign Het
Nek10 T A 14: 14,860,986 (GRCm38) L513M possibly damaging Het
Nrxn2 A T 19: 6,498,308 (GRCm39) S258C possibly damaging Het
Nudt16l2 A T 9: 105,021,786 (GRCm39) S87T possibly damaging Het
Or52e15 G A 7: 104,645,311 (GRCm39) H267Y probably benign Het
Or5m12 C T 2: 85,735,092 (GRCm39) C102Y possibly damaging Het
Or6c1b C T 10: 129,272,948 (GRCm39) T89I probably benign Het
Or6z5 T A 7: 6,477,848 (GRCm39) C246* probably null Het
Or8c15 G T 9: 38,120,586 (GRCm39) C79F probably benign Het
Osgin2 G A 4: 16,013,739 (GRCm39) probably benign Het
Otud3 G A 4: 138,641,060 (GRCm39) R27W probably damaging Het
Pcare C T 17: 72,059,306 (GRCm39) V124I possibly damaging Het
Pcdhga12 T A 18: 37,901,290 (GRCm39) F707L possibly damaging Het
Pik3r1 T C 13: 101,894,118 (GRCm39) E17G probably damaging Het
Pramel19 A G 4: 101,798,788 (GRCm39) E253G probably damaging Het
Prickle4 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 17: 48,000,806 (GRCm39) probably benign Het
Prokr1 G A 6: 87,565,678 (GRCm39) R56W probably benign Het
Ptprz1 G A 6: 23,024,957 (GRCm39) C1731Y probably damaging Het
Rbm15b A T 9: 106,763,028 (GRCm39) F380Y possibly damaging Het
Rfc5 G A 5: 117,524,885 (GRCm39) L56F probably damaging Het
Rhpn2 A T 7: 35,090,228 (GRCm39) M617L probably benign Het
Rusc1 T C 3: 88,995,577 (GRCm39) probably null Het
Sec23ip A G 7: 128,354,634 (GRCm39) N297D probably damaging Het
Sema3c A T 5: 17,880,157 (GRCm39) H259L probably benign Het
Sgsm1 G A 5: 113,428,328 (GRCm39) probably benign Het
Shisal2a A G 4: 108,224,998 (GRCm39) V188A probably benign Het
Sipa1l2 T A 8: 126,218,606 (GRCm39) S244C probably damaging Het
Slc39a5 T C 10: 128,234,316 (GRCm39) I196V probably benign Het
Smim22 G A 16: 4,825,722 (GRCm39) A36T probably damaging Het
Spag6 A G 2: 18,747,588 (GRCm39) I408V probably benign Het
Sult2a5 A G 7: 13,359,311 (GRCm39) I96V probably benign Het
Tmcc2 C A 1: 132,308,517 (GRCm39) A126S probably benign Het
Tsc2 A T 17: 24,819,009 (GRCm39) S1276T probably damaging Het
Ttc21a A G 9: 119,788,103 (GRCm39) S843G probably benign Het
Tubd1 G C 11: 86,443,621 (GRCm39) V110L possibly damaging Het
Ugt1a2 T A 1: 88,128,534 (GRCm39) V59D probably damaging Het
Vmn2r-ps158 A G 7: 42,697,024 (GRCm39) R687G probably damaging Het
Vsig8 T A 1: 172,389,142 (GRCm39) H131Q probably benign Het
Zbtb42 C A 12: 112,646,861 (GRCm39) Y345* probably null Het
Zfp612 T A 8: 110,816,576 (GRCm39) C594* probably null Het
Zfp940 A G 7: 29,544,824 (GRCm39) V361A probably benign Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTTTTATATATGAGGGAGGGAAGGC -3'
(R):5'- TCAAACGGACGCTCTTTCTC -3'

Sequencing Primer
(F):5'- GGCAGTTAAAAATAAAGACCACCTG -3'
(R):5'- CCCCTTTGTGATGAAGCAGCAG -3'
Posted On 2016-03-17